Abstract
Preprotachykinin-A (PPT-A) gene-derived neuropeptides, namely substance P (SP) and neurokinin (NK)A, and their receptors participate in allergen-induced airway responses. Whether airway smooth muscle cells (ASMC) may react directly to SP through expression of the NK-1 receptor or express the gene for the synthesis of SP, the PPT-A gene, is unknown. We demonstrated using reverse transcription–polymerase chain reaction that tracheal SMC (TSMC) from atopic Brown Norway rats contained mRNA transcripts for the full-length isoform of the NK-1 receptor. Flow cytometric analysis indicated that the NK-1 receptor was expressed on the surface of TSMC. This receptor was functional as demonstrated by calcium mobilization in response to SP stimulation. The expression of the NK-1 receptor was not altered in passively sensitized TSMC in response to antigenic stimulation, although this stimulation increased the expression of the chemokine RANTES (regulated on activation, normal T cells expressed and secreted). Using different sets of PCR primers, we showed that TSMC also express the β, α, and its alternative splicing product δ, and possibly the γ mRNA transcript isoforms of the PPT-A gene. Gene sequencing of the PCR-amplified β isoform confirmed that it is a transcript product of the rat PPT-A gene, and the production of SP by TSMC was confirmed by enzyme immunoassay. We also showed the β isoform increased after cell stimulation with rat sera, whether sensitized or not. In conclusion, both the PPT-A gene and NK-1 receptors are expressed by TSMC, which suggests the possibility of autocrine neuropeptidergic mechanisms in these cells. However, these mechanisms are not upregulated by passive sensitization.
Airway smooth muscle (ASM) is likely the key effector tissue of airway hyperresponsiveness in asthma through the increase in airway narrowing caused either by the enhanced smooth muscle mass, such as observed in asthmatic airways (1), or changes in the contractile properties of ASM (2). The participation of the ASM cells (ASMC) in asthma is potentially complex because these cells not only exhibit a contractile but also a noncontractile synthetic (secretory) phenotype (3, 4). The secretory phenotype in ASMC is associated with cell growth and the synthesis and release of proinflammatory mediators such as cytokines and chemokines (5–7). Indeed, ASMC of the secretory phenotype have been suggested to contribute to the persistence of airway inflammation in asthma. Several stimuli may favor the reversion of the contractile to the secretory phenotype of ASMC, including passive sensitization. The latter has been shown to stimulate the secretion of several cytokines by ASMC.
Neurokinins (NKs) are peptides that are synthesized by neural tissues and have been implicated as the mediators of neurogenic inflammation in asthma. Alternative RNA splicing of the preprotachykinin-A (PPT-A) gene in mammals leads to the formation of four PPT-A mRNA transcripts: β and γ encoding for substance P (SP) and neurokinin-A (NKA), and α and δ encoding solely for SP (8). The PPT-A–derived neuropeptides have been identified in the respiratory tract of various mammalian species (9, 10) and interact with the neurokinin (NK)-1 and the NK-2 receptors (11). Pharmacologic studies have demonstrated that many of the proinflammatory processes involved in asthma, such as bronchoconstriction, plasma extravasation, inflammatory cell recruitment, and mucus hypersecretion, are mimicked by NKs (12). SP and NKA induce bronchoconstriction solely in subjects with asthma (13), indicating that hyperresponsiveness to these substances is a feature of asthma. The mechanisms of airway narrowing by NKs are likely several. The administration of NKs to the F344 or BDE rat strains induces a bronchoconstriction that is partly mediated by mast cell–derived mediators (14). NK-1 and NK-2 receptor expression on human and rat ASMC has been shown by immunohistochemistry on lung tissue specimens (15, 16), suggesting a possible direct effect via ASM. In subjects with asthma, mRNA transcripts for the NK-1 and NK-2 receptors have been shown to be upregulated in the airway (17, 18), a process believed to be a consequence of the inflammatory reaction occurring in the allergic airways. However, whether the increased levels of mRNA for both neurokinin receptors in asthmatic airways pertain to the ASMC is unknown.
Capsaicin-induced airways constriction has been shown to be mediated, at least in part, through the release of the neuropeptides from the C-fiber nerves (19). However, nerves are not the exclusive source of these molecules. Non-neuronal cells such as monocytes and macrophages express mRNA transcripts for the PPT-A gene, and capsaicin may induce the release of the neurokinins synthesized by these cells (20). Mononuclear cells also express NK-1 receptors, which suggests the existence of autocrine neuropeptidergic mechanisms in these cells. Whether such a pathway exists in the ASMC is currently unknown. So far, there is no report of the expression of the PPT-A gene in ASMC. The aims of the study were to examine ASMC for the expression of the NK-1 receptor and the PPT-A gene. We also wanted to determine if allergic sensitization modulated the expression of NK-1 receptors and the PPT-A gene by ASMC. To address these issues, we chose to study the Brown Norway (BN) rat, which is an atopic animal, synthesizing large quantities of immunoglobulin (Ig)E following allergic sensitization (21).
Highly inbred BN rats, 7 to 9 wk old, ranging in weight from 180 to 210 g, were purchased from Harlan Sprague-Dawley UK Inc. (Blackthorn, UK). Rats were housed in a conventional animal facility. Animals were killed with an overdose of pentobarbital sodium (Somnotol; MTC Pharmaceuticals, Cambridge, ON, Canada) for the harvesting of tissues.
Primary cultures of tracheal smooth muscle cells (TSMC) were prepared as previously described (22). Briefly, rats were injected intraperitoneally with a lethal dose of pentobarbital, and the tracheas were removed, cut longitudinally through the cartilage, and placed in Hanks' balanced salt solution (HBSS) (in mM: NaCl 137, NaHCO3 4.2, glucose 10, Na2HPO4 3, KCl 5.4, KH2PO4 0.4, CaCl2 1.3, MgCl2 0.5, MgSO4 0.8, N-2-hydroxyethylpiperazine-N′-ethane sulfonic acid 5). Tissue digestion was done by incubating the tracheas for 30 min at 37°C in HBSS containing 0.2% collagenase type IV and 0.05% elastase type V. The dissociated cells were then collected by centrifugation, resuspended in culture medium containing 1:1 Dulbecco's modified Eagle's medium/Ham's F12 medium supplemented with 10% fetal bovine serum (FBS), 0.244% NaHCO3, penicillin (100 U/ml), and streptomycin (100 μg/ml), and plated in 25 cm2 culture flasks. Confluent cells were detached with a 0.25% trypsin-0.02% ethylenediaminetetraacetic acid solution and grown on 25-mm glass coverslips for calcium imaging or in 6-well plates for analysis of NK-1 receptor and PPT-A gene expression. Confluent cells from the first to second passages were used 7 to 12 d after passage. They were identified as SMCs by positive immunohistochemical staining for smooth muscle–specific α-actin and the absence of cytokeratin (23). Cultured TSMC fixed with paraformaldehyde were incubated with blocking buffer (DAKO A/S, Mississauga, ON, Canada) for 1 h at room temperature, and overnight at 4°C with rabbit anti-PGP9.5 antibody (Research Diagnostics, Flanders, NJ) diluted 1:4,000 with antibody diluting buffer (DAKO A/S). Following washing in Tris-buffered saline, cells were incubated for 45 min with biotinylated swine anti-rabbit secondary antibody (DAKO A/S). The presence of antigen was detected by the alkaline phosphatase ABC method (Vector Laboratories, Burlingame, CA) and images acquired by CCD camera using Image Pro software. Frozen sections of rat brain tissues were used as positive control. Immunocytochemical analysis of the eight slides corresponding to different cell culture preparations revealed no immunoreactivity for PG9.5, in contrast to brain slices (data not shown). These results strongly suggest that TSMC cultures were not contaminated by airway intrinsic neurons or C-fiber nerves which are both potential sources of neurokinins (24).
Cytosolic calcium measurements were performed as previously described (23). Briefly, TSCM grown on glass slides were incubated for 20–30 min at 37°C with HBSS containing Ca2+ (CaCl2 1.3 mM) and Mg2+ (MgCl2 0.5 mM and MgSO4 0.8 mM) containing 6 μM Fura-2-acetoxymethylester (Fura-2AM) and 0.02% pluronic F-127. The loaded cells were then washed and the coverslips placed in a Leiden chamber (Medical Systems Corp., Greenville, NY) containing 500 μl of Hanks' buffer on the stage of an inverted microscope equipped for epifluorescence with a ×20 objective (Nikon, Montréal, PQ, Canada). The temperature in the chamber was maintained at 35 ± 0.5°C using a temperature controller (model TC-102; Medical Systems Corp.). Fluorescence measurements of fields containing ∽ 20 cells were made at 345/380 excitatory wavelengths and 510 emission wavelength using a PTI D401 microphotometer (Photon Technology International Inc., Princeton, NJ). Background fluorescence and autofluorescence were automatically subtracted. All test drugs SP and the selective NK-1 receptor antagonist CP-99,994 (Pfizer Pharmaceuticals, Groton, CT) were diluted in Hanks' buffer from frozen stock solutions. They were prewarmed to 35°C before being added in the appropriate concentrations in a 250-μl volume after an equivalent volume of Hanks' buffer had been withdrawn. [Ca2+]i was measured for 30 s before and for 5 min after the addition of the drugs. Only one measurement per slide was performed. The [Ca2+]i was calculated using a calculated dissociation constant of Ca2+ to Fura-2 of 224 nM (22). Maximum ratio was determined in cells exposed to 10−5 M ionomycin in the presence of 1.3 mM CaCl2 and minimum ratio in Ca2+-free Hanks' buffer to which ethyleneglycol-bis-(-aminoethyl ether)-N,N′-tetraacetic acid (EGTA) 10−3 M and ionomycin 10−5 M had been added.
For the analysis of the expression of the NK-1 receptor in TSMC both at the mRNA and protein levels, confluent TSMC in 6-well plates were used after the first or second passages. Cells were washed with free-Ca2+ and Mg2+ HBSS, and single cell suspensions were prepared using 0.25% trypsin-0.02% ethylenediaminetetraacetic acid and after pooling the detached cells from duplicate wells. Pelleted cells were resuspended in 1 ml of free-Ca2+ and Mg2+ HBSS for flow cytometry and RT-PCR analysis.
Total cellular RNA was extracted from cells with TRIZOL (Gibco BRL, Burlington, ON, Canada) and the gene of interest was amplified by reverse transcriptase–polymerase chain reaction (RT-PCR) (25). Briefly, RNA pellets were dissolved in RNAse- and DNase-free tested water (Ambion Inc., Austin, TX). Strand cDNA was made in a 20-μl reaction, using 2 μg of total RNA as template, oligo(dT)12–18 primer, and Superscript II enzyme, in presence of acetylated bovine serum albumin (Gibco BRL) and RNAguard RNase (Pharmacia Biotech, Montreal, PQ, Canada). as enzyme inhibitors. The PCR mixture consisted of (final concentration) 1.5 mM MgCl2, 1× PCR buffer, 0.2 mM dNTP mixture, 2.5 units Platinum Taq polymerase (Gibco BRL), 20 pmol of the upstream and downstream primers, as well as the synthesized cDNA strand. The samples were amplified in a Programmable Thermal Controller (PTC-100; MJ Research Inc., Watertown, MA). The general PCR conditions were: 1 min denaturation at 92°C, 2 min for the annealing, and 3 min of extension at 72°C. The annealing temperature and the number of cycles for each gene of interest are indicated in Table 1
Gene | Upstream primer | Downstream primer | Annealing (°C) | Cycle number | Amplicon (pb) |
|---|---|---|---|---|---|
| NK-1R Long and short isoform | 5′TGCATGGCTGCATTCAATACGGT3′ | 5′TCCTGTTGGGATGCTCCGGCCACT3′ | 56 | 40 | 333 |
| NK-1R Long isoform | 5′GTGATTATGAGGGGCTGGAAT3′ | 5′CTAGGCCAGCATGTTAGAGTAG3′ | 56 | 40 | 238 |
| PPT-A 4 isoforms | 5′CCTTTGAGCATCTTCTTCAGAG3′ | 5′GTAGTTCTGCATTGCGCTTCT3′ | 55 | 42 | β: 235 γ: 190 α: 181 δ: 136 |
| PPT-A 2 isoforms | 5′CCTTTGAGCATCTTCTTCAGAG3′ | 5′TTTCATAAGCCATTTTGTGAGAGA3′ | 55 | 42 | α: 161 δ: 116 |
| RANTES | 5′CCATATGGCTCGGACACCA3′ | 5′CCCACTTCTTCTCTGGGTTG3′ | 56 | 28 | 168 |
| Cyclophilin | 5′GGTCAACCCCACCGTGTTCTTCG3′ | 5′GTGCTCTCCTGAGCTACAGAAGG3′ | 60 | 25 | 553 |
To confirm that TSMC express the PPT-A gene, the amplicon with a size that would correspond to the β isoform has been purified for gene sequencing. Briefly, an aliquot (4 μl) of each four PCR reactions were run on agarose gel stained with ethidium bromide to check the result of the PCR amplifications before being further purified. Two PCR reactions were then pooled and pre-purified using the GFX purification kit (AP Biotech, Montreal, PQ, Canada) according to the manufacturer's instructions. The eluted pre-purified samples were then run on agarose gel containing crystal violet (Sigma, St. Louis, MO) to stain PCR bands and DNA ladders. Gel was visualized on a light box and the band of interest was excised. Gel slices were then mixed with the Capture Buffer (AP Biotech) and cDNA was purified from agarose using the GFX purification kit according to the manufacturer's instructions. The eluted purified cDNA was quantified and an aliquot was electrophoresed on agarose gel stained with ethidium bromide. The purified cDNA was sent to the Laboratory of Gene Sequencing of Université Laval (Laval, QC, Canada) for the determination of the gene sequence by using the upstream or downstream primers used in the initial PCR reaction. The sense and antisense gene sequence results were searched using the NCBI search engine GenBank (NIH).
Confluent TSMC in 25 cm2 culture flasks were used after the first passage and trypsinized as described above. NKs were extracted from cells using the protocol described by Lambrecht and coworkers (27). Briefly, cell pellets (106 cells) were lysed by resuspending in 300 μl 2N glacial acetic acid. SP level of lysates was measured using a sensitive enzyme immunoassay (EIA) kit based on competitive binding (Cayman, Ann Arbor, MI) according to the manufacturer's instructions.
Cells were stained using a procedure previously described for rat cells (28). TSMC in suspension were incubated for 60 min at 4°C with a rabbit antiserum produced against the N terminus peptide of the rat NK-1R (1:200 dilution) kindly provided by Dr. David W. Pascual (Montana State University, Bozeman, MT) (29). This was followed by FITC-conjugated goat anti-rabbit IgG (Sigma ImmunoChemical, St. Louis, MO), and analyzed using a FACScan (Becton Dickinson, San Jose, CA) anc CellQuest software. The negative control was performed using naive rabbit serum at the same dilution followed by the secondary conjugated antibody. To exclude contamination of the TSCM culture by macrophages, another potential source of NKs (20), we used flow cytometry and ED2 conjugated to FITC (Cedarlane, Hornby, ON, Canada).
Ovalbumin (OVA)-specific IgE was measured by ELISA as previously described (21) on serum samples pooled from naive BN rats or pooled from OVA-sensitized animals 2 wk after the initial sensitization. Briefly, 96-well assay plates (Corning Glass Works, Corning, NY) were coated overnight at 4°C with 200 ml of the mouse anti-rat IgE mAb (Zymed, San Francisco, CA) in carbonate-bicarbonate buffer (2 mg/ml). The plates were washed four times with phosphate-buffered saline (PBS)-Tween-azide (0.05% Tween 20 and 0.01% NaN3 in PBS at pH 7.4) and blocked with 0.5% casein and 0.1% Tween 20 in PBS. Then, plates were successively treated with 100 μl of diluted rat serum samples (1:10) at 37°C for 1 h, 100 μl of biotinylated OVA (0.02 mg/ml) at 37°C for 1 h, and alkaline phosphatase–conjugated streptavidin (1:500 dilution; Zymed) at 20°C for 30 min. After addition of p-nitrophenyl phosphate disodium (Sigma) as substrate, plates were developed at 20°C for 45 min and spectrophotometrically read at 405 nm with an ELISA plate reader (400 ATC; SLT Lab Instruments, Pittsburgh, PA).
Confluent TSMC (first passage) were sensitized passively according to the protocol used by Hirata and coworkers (30) for passive sensitization of human bronchial tissues. After three washings of the cultured TSMC with Ca2+- and Mg2+-free HBSS, cells were incubated in 1 ml of culture medium, in 1 ml of pooled sera from naive BN rats, or in 1 ml of pooled sera from OVA-sensitized BN rats. After incubation, the cells were washed three times with Ca2+- and Mg2+-free HBSS, and then culture medium was added. Cells were then stimulated with the allergen at a final concentration of 0.1% OVA and kept in culture for 6 or 18 h, and at the corresponding time point, RNA was extracted and the expression of the NK-1 receptor and PPT-A gene were determined by RT-PCR as described above.
Data are represented as mean ± SEM. Statistical comparison was performed using an ANOVA followed by Fisher's LSD test for comparison of multiple means. A difference was considered to be statistically significant when the P value was less than 0.05.
TSMC were used after the first passage for the investigation of the NK-1 receptor gene expression. Because two isoforms for the NK-1 receptor have been identified, the potential expression of one specific isoform in TSMC was investigated at the mRNA levels by the technique of RT-PCR using two different sets of primers (Table 1). As shown in Figure 1
Figure 1. Expresssion of the neurokinin-1 (NK-1) receptor in tracheal smooth muscle cells (TSMC) of BN rats. Cells were harvested for RNA extraction after the first passage (n = 3). The expression of NK-1 receptors was determined by RT-PCR using two different sets of primers that allow the detection of a sequence present both in the full-length and short isoforms, or a sequence uniquely present in the full-length isoform (see Methods and Table 1 for details). Brain tissue was used as a positive control of the NK-1 receptor expression and cyclophilin as housekeeping gene. M: DNA molecular weight markers.
[More] [Minimize]Flow cytometry of a suspension of TSMC for the NK receptor revealed that the NK-1 receptor is expressed on 69.0 ± 2.7% of the airway cells. Furthermore, the shape of the distribution curve suggests that cells bearing NK-1 receptors are unlikely to be a distinct subpopulation of TSMC (Figure 2)
Figure 2. Flow cytometric analysis of the expression of NK-1 receptors on TSMC. Confluent cells were harvested after the first passage. (A) A representative illustration of the forward and side scatter of the cultured TSMC population. (B) Flow cytometric analysis of NK-1 receptors expression on TSMC stained with a rabbit antiserum produced against the N terminus peptide of the rat NK-1R (thick line). The dash line represents staining with the negative control polyclonal antibodies (rabbit naive serum, dilution 1:200). Shaded histogram represents the unstained cells. Representative results of three separate experiments are shown. C: unlabeled cells. The two windows used for data analysis have been named respectively as M1 and M2.
[More] [Minimize]
Figure 3. Flow cytometric analysis of the effect of cell passages on the expression of NK-1 receptors on TSMC. After the first passage, part of the trypsinized cells was used for cell culture and the other kept for further analysis of receptor expression by flow cytometry. The confluent cells from the second passage were then harvested, both cells from the first and second passage stained for the determination of NK-1 receptor expression by flow cytometry as described in the legend of Figure 2. Data are expressed as percent of positive labeled cells from three separate cell preparation.
[More] [Minimize]Evidence for the expression of the NK-1 receptor on TSMC was determined by measuring change in [Ca2+]i in response to SP stimulation. Calcium measurements represent the response of an average of 20 cells in the field. As illustrated in Figure 4
Figure 4. Time course of SP-induced [Ca2+]i in TSMC. Confluent cells were used after the first passage and exposed to SP (10−6 M) and change in [Ca2+]i was recorded from ∽ 20 cells. The trace is from representative experiments repeated three times.
[More] [Minimize]Several cell types have been reported to both express the NK-1 receptor and to produce their own NKs. To address this possibility for TSMC, the expression of the different PPT-A mRNA isoforms was determined by RT-PCR. As shown in Figure 5
Figure 5. Expresssion of the PPT-A gene in tracheal smooth muscle cells (TSMC) of BN rats. Cells were harvested for RNA extraction after the first passage (n = 5). (A) The expression of mRNA transcripts for the PPT-A gene was determined by RT-PCR using a set of primers that allows the detection of the four mRNA isoforms of the PPT-A gene or (B) allowing the selective detection of the α and its alternative splicing product δ in using a different downstream primer (Table 1). (C) cyclophilin was used as housekeeping gene. Rat brain tissue was used as a positive control of the PPT-A gene expression. M: DNA molecular weight markers.
[More] [Minimize]To exclude contamination of the TSMC culture by macrophages, we performed flow cytometry with a macrophage-specific marker, ED2. This surface marker was expressed by 36–45% of alveolar macrophages harvested from the BN rat (n = 3). There was no detectable expression of this marker on TSMC (data not shown). Furthermore, to exclude contamination of cell cultures by intrinsic airway neurons or C-fiber nerves, we performed immunocytochemical analysis with a specific nerve marker, PGP9.5. In contrast to rat brain tissues used as positive control, there was no detectable expression of this marker on slides of TSMC culture preparations (eight preparations were tested; data not shown).
OVA-specific IgE was significantly higher in the pooled sera of OVA-sensitized rats compared with those in negative control unsensitized animals (1.197 ± 0.125 optical density unit in IgE-rich sera versus 0.027 ± 0.007 optical density unit in naive rat sera; triplicate). To investigate the potential modulation of the expression of the NK-1 receptors in allergic conditions, confluent TSMC were incubated for 1 h with culture medium (control cells), the pooled sera from naive BN rats (unsensitized cells), or the pooled sera from OVA-sensitized BN rats (passively sensitized cells). Control (C), unsensitized (NS), and passively sensitized (SS) TSMC were stimulated for 6 or 18 h with 0.1% OVA, and the total RNA was extracted for RT-PCR analysis of gene expression. As shown in Figure 6A
Figure 6. Effects of antigen challenge in the expression of NK-1 receptors in passively-immunized TSMC. Confluent cells were incubated for 1 h with culture medium (control cells), the pooled sera from naive BN rats (unsensitized cells), or the pooled sera from OA-sensitized BN rats (passively sensitized cells). Control (C), unsensitized (NS), and passively sensitized (SS) TSMC were stimulated for 6 or 18 h with 0.1% OVA, and the total RNA was extracted for RT-PCR analysis of gene expression. (A) Expression of NK-1 receptors (black bars) and (B) RANTES (gray bars). Semiquantitative analysis of gene expression was performed. Data are expressed as the ratio of band intensities (densitometric analysis) for the gene of interest versus the housekeeping gene cyclophilin amplified in PCR conditions avoiding signal saturation (Table 1). Pictures of ethidium bromide–stained agarose gel are shown in inserts and are from representative experiments repeated three times. *P < 0.01 from values compared with respective controls (C and NS groups), as assessed with an ANOVA followed by Fisher's LSD.
[More] [Minimize]
Figure 7. Effects of antigen challenge in the expression of the PPT-A gene in passively-immunized TSMC. Confluent cells were incubated for 1 h with culture medium (control cells), the pooled sera from naïve BN rats (unsensitized cells), or the pooled sera from OVA-sensitized BN rats (passively sensitized cells). Cells were stimulated and gene expression was determined as described in the legend of Figure 6. Semiquantitative analysis of the expression of the β-isoform of the PPT-A gene was performed. Data are expressed as the ratio of band intensities (densitometric analysis) for the β-isoform versus cyclophilin (cyclo) amplified in PCR conditions avoiding signal saturation (Table 1). Pictures of ethidium bromide–stained agarose gel are shown in inserts and are from representative experiments repeated three times. Statistical differences among groups were assessed with an ANOVA following by Fisher's LSD. ns: not significant.
[More] [Minimize]TSMC from the BN rats were isolated and cultured to investigate the expression of the NK-1 receptor on these cells and its possible modulation by allergic sensitization. Furthermore, the potential existence of autocrine neuropeptidergic mechanisms in ASMC was investigated through the determination of PPT-A gene expression in these cells. The expression of NK-1 receptors on TSMC in culture was first determined by the detection of mRNA transcripts for this receptor. Interestingly, the examination of the expression of NK-1 receptors on the cell surface indicated that this receptor was expressed on a substantial fraction of TSMC. NK-1 receptors expressed on TSMC are functional, as demonstrated by SP-induced calcium mobilization in these cells. Antigenic stimulation of passively sensitized TSMC did not alter the levels of expression of the NK-1 receptors, whereas this treatment increased the expression of the C-C chemokine RANTES. Interestingly, similar to nerves and some non-neuronal cell populations, TSMC expressed mRNA transcripts of the PPT-A gene.
NK-1 receptors are localized on bronchial smooth muscle of several mammalian species, including human (15, 16), suggesting a role for neurokinins in mediating bronchoconstriction. However, to our knowledge no studies have described the expression of the NK-1 receptor on the ASMC in culture. In the present study, RT-PCR analysis of the RNA extracted from TSCM in culture revealed the presence of mRNA transcripts for the NK-1 receptor. Immunocytochemical studies have indicated the existence of two isoforms for this receptor in the human and rat brain (26, 31). The two isoforms, denoted full-length and truncated forms, differ only in the length of the carboxyl-terminal tail, for which the truncated isoform contains a very short carboxyl-terminal sequence extending only seven amino acids beyond the seventh transmembrane domain (32). Two cDNA clones encoding two isoforms of the human NK-1 receptor have been described (31). In rats, the short isoform has not been cloned. However, based on the amino sequence missing in the rat NK-1 truncated receptor, we designed PCR primers that anneal uniquely to the sequence coding for a portion of the carboxyl-terminal tail of the full-length isoform. Using these primers, our results indicated that rat TSMC expressed the full-length NK-1 receptor isoform, although the expression of the short isoform cannot be excluded. Experiments are currently ongoing to clone the short isoform of the rat NK-1 receptors, which will allow the design of primers to anneal gene sequences that are exclusively expressed in the short isoform. Flow cytometric analysis confirmed the expression of NK-1 receptors on the surface of the rat TSMC. Approximately 70% of the cells were positive for the receptor, but the shape of the frequency distribution was not suggestive of a distinct subpopulation of cells bearing NK-1 receptors. Whether the expression of NK-1 receptors on TSMC is preferentially expressed on cells whose phenotype is more contractile than secretory is unknown. Such a dichotomy is not likely, because SP has been reported to induce not only the contraction of ASMC but also is a mitogenic factor for these cells (33). We have also investigated the effect of the number of cell passages on the expression of NK-1 receptors on TSMC. We found that after two cell passages the expression of this receptor on the cell surface was not altered. This result suggests that NK-1 receptors may have a role in regulating ASM processes even in vitro. The possibility that NKs may mediate TSMC proliferation was not investigated in the present study. However, Noveral and Grunstein have shown that SP, but not NKA, is a mitogenic factor for human ASMC in culture, and that its action is mediated through the selective activation of the NK-1 receptor (33). The expression of both the PPT-A gene and NK-1 receptors by macrophages has been interpreted as evidence for an autocrine mechanism regulating cell function through neuropeptidergic pathways (20). Whether during the process of cell growth the TSMC produce their own NKs was unknown, but was an idea with ample precedent. The known production of NKs by macrophages and neurons prompted us to exclude these cell types as possible contaminants of the TSMC cultures. To this end, flow cytometric analysis of the cells for a cell surface marker specific for macrophages and immunohistochemical staining for a neuron-specific marker were performed, and did not reveal any evidence of contamination.
We demonstrated the expression of the PPT-A gene in TSMC. Similarly to BN rat brain tissue, TSMC expressed mainly the β isoform mRNA transcript of the PPT-A gene, as well as the α and δ isoforms encoding uniquely for SP. The sequencing of the isolated amplicon with a size that corresponds to the β isoform of the PPT-A gene confirmed that the amplified sequence is a transcript product of the rat PPT-A gene. Furthermore, mRNA transcripts for the PPT-A gene contained in TSMC lead to the translated mature peptide as determined by the presence of substantial intracellular levels of SP, measured by EIA. This finding suggests that NKs may regulate SMC functions in an autocrine fashion. The potential importance of such autocrine effects is supported by our data indicating that incubation of TSMC with BN rat serum increases the expression of the PPT-A gene. Indeed, whether the PPT-A gene–derived neuropeptides modulate TSMC cell growth or other function exists is unknown but may be expected. This finding may also have some importance in the context of the physiopathology of asthma. Indeed, allergen-induced increase in plasma exudation in the airways may lead to an augmentation of the PPT-A gene–derived neuropeptide synthesis/release. Subsequently these neuropeptides would be expected to contribute, at least in part, to the development of the late bronchoconstriction. To date there are no data to implicate the PPT-A neuropeptides in allergen-induced late bronchoconstriction in subjects with asthma. However, we (25) and others (34) have shown in experimental animal models of asthma that both SP and NKA, through their actions on NK-1 and NK-2 receptors, contribute to the development of the late airway response. It remains to be demonstrated that TSMC may be a significant source of NKs during such reactions.
The prevalence of asthma and the degree of airway hyperresponsiveness are associated with increased total serum IgE levels (35). Furthermore, in vitro studies have shown that airway isolated from subjects with high total IgE levels are hyperresponsive to histamine in contrast to airways obtained from subjects with low serum IgE (36). Interestingly, passive sensitization of human isolated airways with IgE-rich serum not only induced a specific response to allergen, but also increased responsiveness to various spasmogenic agents (37). Recently, ASMC have been shown to express the low-affinity IgE receptor FcεRII (CD23), receptor expression of which is upregulated in airway SM tissues from subjects with asthma (38). Passive sensitization with IgE-rich serum of isolated human airway SM tissues and cultured cells induced an early increased mRNA expression of the Th2-type cytokines and their receptors, which was later followed by enhanced mRNA expression of the Th1-type cytokines as well as their receptors (5). These findings indicate that ASMC have the capacity to respond to antigenic stimuli and may actively participate in the inflammatory responses ongoing in the asthmatic airways. In the present study, antigenic stimulation of passively sensitized TSMC in culture did not alter the expression of NK-1 receptors, whereas it increased the expression of the C-C chemokine RANTES. This upregulation of RANTES in TSMC is in agreement with previous studies on human tissues, indicating that RANTES is constitutively expressed in ASMC and upregulated in subjects with asthma (7).
In conclusion, TSMC of the BN rat expresses the NK-1 full-length isoform, which is functional and leads to increases in intracellular calcium. This receptor may therefore mediate contractile and proliferative responses of these cells. There is evidence for a possible role for this receptor in autocrine NK–mediated processes in TSMC, because the NKs themselves are expressed. Therefore, we postulate that increases in plasma protein exudation in allergic airways lead to synthesis/release of NKs from the ASMC which are responsible, at least in part, for the development of the late bronchoconstriction. There is no evidence that hyperresponsiveness to NKs, such as is seen in subjects with asthma, may be mediated by NK-1 receptor upregulation related to IgE binding to the cell surface.
Dr. Karim Maghni is supported by the Médecine-Relève 2000 program of the Université de Montréal. We thank Ms. Jamilah Saeed and Dr. B. Tolloczko for valuable technical assistance. The authors also acknowledge the Cystic Fibrosis Foundation for financing part of this project. This study was supported by CIHR grants # MOP-36334 and # MOP-57742, and by the Canadian Cystic Fibrosis Foundation.
| 1. | Hossain, S. 1973. Quantitative measurement of bronchial muscle in men with asthma. Am. Rev. Respir. Dis. 107:99–109. |
| 2. | Lambert, R. K., B. R. Wiggs, K. Kuwano, J. C. Hogg, and P. D. Pare. 1993. Functional significance of increased airway smooth muscle in asthma and COPD. J. Appl. Physiol. 74:2771–2781. |
| 3. | Hirst, S. J. 1996. Airway smooth muscle cell culture: application to studies of airway wall remodelling and phenotype plasticity in asthma. Eur. Respir. J. 9:808–820. |
| 4. | Halayko, A. J., H. Salari, X. Ma, and N. L. Stephens. 1996. Markers of airway smooth muscle cell phenotype. Am. J. Physiol. 270:L1040–L1051. |
| 5. | Hakonarson, H., N. Maskeri, C. Carter, and M. M. Grunstein. 1999. Regulation of TH1- and TH2-type cytokine expression and action in atopic asthmatic sensitized airway smooth muscle. J. Clin. Invest. 103:1077–1087. |
| 6. | Ghaffar, O., Q. Hamid, P. M. Renzi, Z. Allakhverdi, S. Molet, J. C. Hogg, S. A. Shore, A. D. Luster, and B. Lamkhioued. 1999. Constitutive and cytokine-stimulated expression of eotaxin by human airway smooth muscle cells. Am. J. Respir. Crit. Care Med. 159:1933–1942. |
| 7. | John, M., S. J. Hirst, P. J. Jose, A. Robichaud, N. Berkman, C. Witt, C. H. Twort, P. J. Barnes, and K. F. Chung. 1997. Human airway smooth muscle cells express and release RANTES in response to T helper 1 cytokines: regulation by T helper 2 cytokines and corticosteroids. J. Immunol. 158:1841–1847. |
| 8. | Nawa, H., H. Kotani, and S. Nakanishi. 1984. Tissue-specific generation of two preprotachykinin mRNAs from one gene by alternative RNA splicing. Nature 312:729–734. |
| 9. | Ollerenshaw, S. L., D. Jarvis, C. E. Sullivan, and A. J. Woolcock. 1991. Substance P immunoreactive nerves in airways from asthmatics and nonasthmatics. Eur. Respir. J. 4:673–682. |
| 10. | Wharton, J., J. M. Polak, S. R. Bloom, J. A. Will, M. R. Brown, and A. G. Pearse. 1979. Substance P-like immunoreactive nerves in mammalian lung. Invest. Cell Pathol. 2:3–10. |
| 11. | Regoli, D., A. Boudon, and J. L. Fauchere. 1994. Receptors and antagonists for substance P and related peptides. Pharmacol. Rev. 46:551–599. |
| 12. | Barnes, P. J. 2001. Neurogenic inflammation in the airways. Respir. Physiol. 125:145–154. |
| 13. | Cheung, D., H. van der Veen, J. den Hartigh, J. H. Dijkman, and P. J. Sterk. 1994. Effects of inhaled substance P on airway responsiveness to methacholine in asthmatic subjects in vivo. J. Appl. Physiol. 77:1325–1332. |
| 14. | Joos, G. F., J. C. Kips, and R. A. Pauwels. 1994. In vivo characterization of the tachykinin receptors involved in the direct and indirect bronchoconstrictor effect of tachykinins in two inbred rat strains. Am. J. Respir. Crit. Care Med. 149:1160–1166. |
| 15. | Mapp, C. E., D. Miotto, F. Braccioni, M. Saetta, G. Turato, P. Maestrelli, J. E. Krause, V. Karpitskiy, N. Boyd, P. Geppetti, and L. M. Fabbri. 2000. The distribution of neurokinin-1 and neurokinin-2 receptors in human central airways. Am. J. Respir. Crit. Care Med. 161:207–215. |
| 16. | Ichikawa, S., S. P. Sreedharan, R. L. Owen, and E. J. Goetzl. 1995. Immunochemical localization of type I VIP receptor and NK-1-type substance P receptor in rat lung. Am. J. Physiol. 268:L584–L588. |
| 17. | Bai, T. R., D. Zhou, T. Weir, B. Walker, R. Hegele, S. Hayashi, K. McKay, G. P. Bondy, and T. Fong. 1995. Substance P (NK1)- and neurokinin A (NK2)-receptor gene expression in inflammatory airway diseases. Am. J. Physiol. 269:L309–L317. |
| 18. | Katsunuma, T., J. C. Mak, and P. J. Barnes. 1998. Glucocorticoids reduce tachykinin NK2 receptor expression in bovine tracheal smooth muscle. Eur. J. Pharmacol. 344:99–106. |
| 19. | Murai, M., Y. Maeda, D. Hagiwara, H. Miyake, N. Ikari, M. Matsuo, and T. Fujii. 1993. Effects of an NK1 receptor antagonist, FK888, on constriction and plasma extravasation induced in guinea pig airway by neurokinins and capsaicin. Eur. J. Pharmacol. 236:7–13. |
| 20. | Ho, W. Z., J. P. Lai, X. H. Zhu, M. Uvaydova, and S. D. Douglas. 1997. Human monocytes and macrophages express substance P and neurokinin-1 receptor. J. Immunol. 159:5654–5660. |
| 21. | Waserman, S., R. Olivenstein, P. Renzi, L. J. Xu, and J. G. Martin. 1992. The relationship between late asthmatic responses and antigen-specific immunoglobulin. J. Allergy Clin. Immunol. 90:661–669. |
| 22. | Tolloczko, B., Y. L. Jia, and J. G. Martin. 1995. Serotonin-evoked calcium transients in airway smooth muscle cells. Am. J. Physiol. 269:L234–L240. |
| 23. | Michoud, M. C., B. Tolloczko, and J. G. Martin. 1997. Effects of purine nucleotides and nucleoside on cytosolic calcium levels in rat tracheal smooth muscle cells. Am. J. Respir. Cell Mol. Biol. 16:199–205. |
| 24. | Fontan, J. J., D. N. Cortright, J. E. Krause, C. R. Velloff, V. V. Karpitskyi, T. W. Carver, Jr., S. D. Shapiro, and B. N. Mora. 2000. Substance P and neurokinin-1 receptor expression by intrinsic airway neurons in the rat. Am. J. Physiol. Lung Cell. Mol. Physiol. 278:L344–L355. |
| 25. | Maghni, K., R. Taha, W. Afif, Q. Hamid, and J. G. Martin. 2000. Dichotomy between neurokinin receptor actions in modulating allergic airway responses in an animal model of helper T cell type 2 cytokine-associated inflammation. Am. J. Respir. Crit. Care Med. 162:1068–1074. |
| 26. | Mantyh, C. R., S. R. Vigna, R. R. Bollinger, P. W. Mantyh, J. E. Maggio, and T. N. Pappas. 1995. Differential expression of substance P receptors in patients with Crohn's disease and ulcerative colitis. Gastroenterology 109:850–860. |
| 27. | Lambrecht, B. N., P. R. Germonpre, E. G. Everaert, I. Carro-Muino, M. De Veerman, C. de Felipe, S. P. Hunt, K. Thielemans, G. F. Joos, and R. A. Pauwels. 1999. Endogenously produced substance P contributes to lymphocyte proliferation induced by dendritic cells and direct TCR ligation. Eur. J. Immunol. 29:3815–3825. |
| 28. | Maghni, K., O. M. Nicolescu, and J. G. Martin. 1999. Suitability of cell metabolic colorimetric assays for assessment of CD4+ T cell proliferation: comparison to 5-bromo-2-deoxyuridine (BrdU) ELISA. J. Immunol. Methods 223:185–194. |
| 29. | van Ginkel, F. W., and D. W. Pascual. 1996. Recognition of neurokinin 1 receptor (NK1-R): an antibody to a peptide sequence from the third extracellular region binds to brain NK1-R. J. Neuroimmunol. 67:49–58. |
| 30. | Hirata, N., H. Kohrogi, H. Iwagoe, E. Goto, J. Hamamoto, K. Fujii, T. Yamaguchi, O. Kawano, and M. Ando. 1998. Allergen exposure induces the expression of endothelial adhesion molecules in passively sensitized human bronchus: time course and the role of cytokines. Am. J. Respir. Cell Mol. Biol. 18:12–20. |
| 31. | Fong, T. M., S. A. Anderson, H. Yu, R. R. Huang, and C. D. Strader. 1992. Differential activation of intracellular effector by two isoforms of human neurokinin-1 receptor. Mol. Pharmacol. 41:24–30. |
| 32. | Kage, R., S. E. Leeman, and N. D. Boyd. 1993. Biochemical characterization of two different forms of the substance P receptor in rat submaxillary gland. J. Neurochem. 60:347–351. |
| 33. | Noveral, J. P., and M. M. Grunstein. 1995. Tachykinin regulation of airway smooth muscle cell proliferation. Am. J. Physiol. 269:L339–L343. |
| 34. | Schuiling, M., A. B. Zuidhof, J. Zaagsma, and H. Meurs. 1999. Role of tachykinin NK1 and NK2 receptors in allergen-induced early and late asthmatic reactions, airway hyperresponsiveness, and airway inflammation in conscious, unrestrained guinea pigs. Clin. Exp. Allergy 29:48–52. |
| 35. | Sears, M. R., B. Burrows, E. M. Flannery, G. P. Herbison, C. J. Hewitt, and M. D. Holdaway. 1991. Relation between airway responsiveness and serum IgE in children with asthma and in apparently normal children. N. Engl. J. Med. 325:1067–1071. |
| 36. | Schmidt, D., N. Watson, E. Ruehlmann, H. Magnussen, and K. F. Rabe. 2000. Serum immunoglobulin E levels predict human airway reactivity in vitro. Clin. Exp. Allergy 30:233–241. |
| 37. | Black, J. L., R. Marthan, C. L. Armour, and P. R. Johnson. 1989. Sensitization alters contractile responses and calcium influx in human airway smooth muscle. J. Allergy Clin. Immunol. 84:440–447. |
| 38. | Hakonarson, H., C. Carter, C. Kim, and M. M. Grunstein. 1999. Altered expression and action of the low-affinity IgE receptor FcepsilonRII (CD23) in asthmatic airway smooth muscle. J. Allergy Clin. Immunol. 104:575–584. |
