Fine particles in the air have been associated with increased mortality and morbidity. Particulate air pollution is a complex mixture which varies by region and includes a number of components including residual oil fly ash (ROFA), a byproduct of power plant and industry fuel-oil combustion. Human airway epithelial cells exposed to ROFA release inflammatory cytokines including interleukin (IL)-6, IL-8, and tumor necrosis factor. Expression of these genes is dependent upon pretranscriptional binding of cis regulatory elements, including nuclear factor κB (NF-κB). To investigate the role of NF-κB in the particulate-induced IL-6 response, we exposed human airway epithelial cells (BEAS-2B) to ROFA in vitro. ROFA stimulated a time- and dose-dependent increase in IL-6 messenger RNA (mRNA), which was preceded by the activation of nuclear proteins binding to the NF-κB sequence motif in the IL-6 promoter. Transient transfection of BEAS-2B cells with the 5′ promoter region of the IL-6 gene linked to a luciferase reporter gene confirmed that NF-κB binding is necessary for the transcription of IL-6 mRNA. The IL-6 response was inhibited by the metal chelator deferoxamine and the free radical scavenger N-acetyl-l-cysteine, suggesting that the activation of NF-κB may be mediated through reactive oxygen intermediates generated by transition metals found in ROFA. Activation of NF-κB may therefore be a critical first step in the inflammatory cascade following exposure to particles generated by oil combustion.
Recent epidemiological studies have associated particulate air pollution, especially particles less than 10 μm in size (PM10), with increased mortality and morbidity (1-3). Ambient air PM10 exposures also correlate with increased incidence of respiratory illnesses such as bronchitis, pneumonia, and respiratory failure (4, 5). Although a specific mechanism of toxicity has yet to be identified, a number of PM10 components have been suggested as causative agents, including transition metals, bio-aerosols, ultra-fine particles, acids, and organic compounds (6, 7).
As a group, transition metals garner attention because of their highly reactive nature. Occupational exposure to vanadium and nickel has been shown to induce respiratory irritation and changes in pulmonary function (8-11). These and other first-row transition metals have the capacity to support electron exchange and catalyze free radical production (12). It has been postulated that transition metals (iron, nickel, vanadium, copper) present in particulate pollution contribute to PM10-associated adverse effects by producing free radicals in the lung (12, 13). Production of free radicals can result in lung injury, inflammation, and alterations in pulmonary host defense. We further suggest that these effects, while detectable in all individuals, are not severe enough to cause overt mortality/morbidity in healthy individuals. However, in some elderly and otherwise compromised individuals the effects may result in hypoxemic events which stress the cardiovascular system enough to result in mortality or morbidity.
Residual oil fly ash (ROFA) is a particularly good particulate source for exploring the role played by transition metals in lung inflammation. ROFA, a byproduct of oil combustion, is an important emission source of metal containing particulates, characterized by a high vanadium content in addition to the presence of nickel and iron (12, 13). It is emitted by power plants and other industries that burn heavy oil and contains substantial levels of several transition metals, but almost no organic or biologic components (13). Fugitive fly ash from the combustion of oil and residual fuel oil contributed 76,000 and 49,000 tons to the national ambient particle burden in 1992 (14). A significant contribution of ROFA to ambient air pollution particles is supported further by measurable concentrations of vanadium, a metal specific to combustion of heavy fuel oils, in particles collected on filters in many different cities around the country (14).
Instillation of metal-containing urban air particles, including ROFA, into rats produces an inflammatory response in the lung as measured by increased influx of polymorphonuclear leukocytes (PMNs) into the lung (12, 13). The degree of inflammation was correlated with the transition metal content of the dust as well as the generation of free radicals by the dusts in vitro. Alveolar macrophages and epithelial cells are the primary initiators of the inflammatory response in the lung, activating host defense mechanisms and recruiting inflammatory cells via the secretion of cytokines and chemokines. ROFA does not induce the production of cytokines or other inflammatory mediators in human or rat alveolar macrophages in vitro (16). However, epithelial cells lining the respiratory tract may also interact with inhaled particles or soluble components released by inhaled particles, and effect an inflammatory response. These cells can produce cytokines which are chemotactic for inflammatory cells (17, 18), and oxidants such as ozone have been shown to stimulate the release of interleukin (IL)-6, IL-8, and tumor necrosis factor (TNF) from human airway epithelial cells (19).
We have previously shown that human airway epithelial cells exposed to ROFA produce significant amounts of IL-6, IL-8, and TNF, as well as messenger RNAs (mRNAs) coding for these cytokines (20). These cytokines have been implicated in several respiratory toxicant-induced pathologies including pneumoconiosis, silicosis (21), and metal fume fever (22). ROFA-induced increases in IL-6, IL-8, and TNF can be inhibited by deferoxamine, a metal chelator, and dimethylthiourea, a free radical scavenger (20). Expression of these genes is controlled by a number of DNA-binding proteins which interact with specific sequence motifs in the promoter region of the gene. Many cytokine genes are regulated in part by nuclear factor κB (NF-κB), a widely distributed transcription factor which is normally sequestered in the cytoplasm as an inactive multi-unit complex bound by an inhibitory protein (I-κB) (23). A number of stimuli can activate the complex by causing phosphorylation and degradation of I-κB and translocation of the active dimer into the nucleus, where it binds to the promoter region of genes containing the NF-κB motif and stimulates their expression.
The generation of reactive oxygen species (ROS) has been associated with NF-κB activation by a variety of stimuli (23, 24). Since ROFA-induced inflammation in rats and in airway epithelial cells is mediated by the production of ROS, we have proposed that the ability of ROFA to induce the expression of IL-6, IL-8, and TNF is mediated at least in part by NF-κB. Here we demonstrate that ROFA induces binding of NF-κB protein to the NF-κB sequence motif, and stimulates NF-κB-mediated IL-6 transcription. These events are blocked by a metal chelator and a free radical scavenger, further supporting the notion that epithelial cells exposed to ROFA induce IL-6 expression by activation of NF-κB, which is mediated by ROS generated by transition metals.
The human airway epithelium derived cell line BEAS-2B (S6 subclone) (25) was obtained from Drs. Curtis Harris and John Lechner (NIH). The cells (passages 60–90) were maintained in Keratinocyte Growth Medium (KGM) (Clonetics, San Diego, CA) supplemented with bovine pituitary extract, 5 ng/ml human epidermal growth factor, 500 ng/ml hydrocortisone, 0.1 mM ethanolamine, 0.1 mM phosphoethanolamine, and 5 ug/ml insulin. Cells were plated on tissue culture dishes and grown to confluence prior to treatment.
ROFA was provided by Drs. A. J. Ghio and G. E. Hatch (U.S. EPA). It was collected by the Southern Research Institute (Birmingham, AL) on a Teflon-coated fiberglass filter downstream from the cyclone (“scrubber”) of a power plant in Florida. At the time of collection the plant was burning a low-sulfur number 6 residual oil at an effluent temperature of 204°C. The physiocochemical characteristics of this batch of fly ash have been reported elsewhere (12, 13). ROFA was suspended in KGM at a 1-mg/ ml concentration and vortexed vigorously immediately prior to adding to cell monolayers. A working concentration of 50 μg/ml ROFA was prepared and 1 ml of suspension was added to each well for 1 to 24 h. This was considered a nontoxic dose, as reported previously and determined by trypan blue dye exclusion and lactate dehydrogenase release (20). In some experiments deferoxamine (DEF) and N-acetyl-l-cysteine (NAC; Sigma Chemical, St. Louis, MO) were added 30 min prior to ROFA exposure at 1 mM and 30 mM final concentrations, respectively.
Cells were lysed in GITC buffer (4 M guanidine isothiocyanate [Boehringer Mannheim, Indianapolis, IN], 25 mM sodium citrate [pH 7.0], 0.5% sarkosyl, and 0.14 M 2-mercaptoethanol) and RNA was pelleted through a cesium chloride gradient. First-strand complementary DNAs (cDNAs) were synthesized from 0.1 μg of total RNA in 50 μl of a buffer containing 5 μM random hexaoligonucleotide primers (Pharmacia, Piscataway, NJ), 10 U/μl Moloney murine leukemia virus reverse transcriptase (GIBCO BRL Life Technologies, Gaithersburg, MD), 1 U/μl RNasin (Promega, Madison, WI), 0.5 mM dNTP (Pharmacia), 50 mM KCl, 3 mM MgCl2, and 10 mM Tris-HCl (pH 9.3). Following a 1-h incubation at 39°C, the reverse transcriptase was heat-inactivated at 94°C for 4 min.
PCR was performed on 2 μl of the cDNA template in 50 μl of amplification buffer containing 10 mM Tris-HCl (pH 9.3), 50 mM KCl, 3 mM MgCl2, 0.1 mg/ml bovine serum albumin (BSA), 50 μM dNTP, 1.25 U of Taq DNA polymerase (Promega), and 200 nM each of the oligonucleotide primer pairs using a thermocycler (MJ Research, Cambridge, MA). Oligonucleotide sequences were synthesized using an Applied Biosystems 391 DNA synthesizer (Foster City, CA) based on sequences published in the GenBank human DNA database. All of the oligonucleotide primers used for quantitation were designed to amplify segments of the mature mRNA derived from two or more gene exons, so that amplification of genomic sequences will yield products larger than products derived from mature mRNA. Only amplification products of the size predicted by the mature mRNA sequence were quantified. Inappropriately large amplification products were not observed for any of the primer pairs. The following sense and antisense sequences were employed: glyceraldehyde-3-phosphate dehydrogenase (GAPDH): sense CCATGGAGAAGGCTGGGG; antisense CAAAGTTGTCATGGATGACC; IL-6: sense CTTCTCCACAAGCGCCTTC; antisense CTCCTCATTGAATC. Following amplification, 10 μl of each reaction was separated by alkaline gel electrophoresis through 2% agarose gels in 1× Tris-borate, ethylenediaminetetraacetic acid (EDTA) buffer. The gel was stained in 1 μg/ml ethidium bromide and photographed under ultraviolet (UV) illumination with Polaroid type 55 P/N film (Polaroid, Cambridge, MA).
Cells were plated in 100-mm tissue culture dishes and exposed to various concentrations of ROFA or TNF for 1 h. Nuclear extracts were prepared from 10 × 106 cells. Adherent cultures were washed twice with phosphate-buffered saline and equilibrated for 10 min on ice with 1 ml of cold cytoplasmic extraction buffer (CEB; 10 mM Tris-HCl, pH 7.9, 60 mM KCl, 1 mM EDTA, 1 mM dithiothreitol [DTT]) with protease inhibitors (PI; 1 mM Pefabloc, 50 μg/ml antipapain, 1 μg/ml leupeptin, 1 μg/ml pepstatin, 40 μg/ml bestatin, 3 μg/ml E-64, 100 μg/ml chymostatin; all purchased from Boehringer Mannheim). NP-40 was added to a final concentration of 0.1% and cells were dislodged with a cell scraper. Nuclei were pelleted by centrifugation at 500 × g for 10 min and washed with CEB/PI. Nuclei were incubated for 10 min on ice in nuclear extraction buffer (20 mM Tris-HCl, pH 8.0, 400 mM NaCl, 1.5 mM MgCl2, 1.5 mM EDTA, 1 mM DTT, 25% glycerol) with PI, spun briefly to clear debris, and stored at −80°C.
DNA–protein binding reactions were performed using 2 μg of nuclear protein (as determined by Bradford dye binding; Bio-Rad, Richmond, CA) and 0.3 ng of 32P-labeled DNA probe (probe sequences are shown in Table 1). DNA oligonucleotides were synthesized on an Applied Biosystems Model 391 DNA synthesizer (Perkin-Elmer, Foster City, CA). Reactions were incubated for 10 min at room temperature in buffer containing 10 mM Tris-HCl, pH 7.9, 50 mM NaCl, 2.5 mM EDTA, 1 mM DTT, 5 μg BSA, 0.1 μg poly dI-dC, 4% ficoll. In some experiments, antibodies specific to NF-κB subunits (Santa Cruz Biotechnology, Santa Cruz, CA) were added and the reaction was allowed to continue for an additional 15 min at room temperature. Samples were electrophoresed on a 5% nondenaturing polyacrylamide gel in Tris, Glycine, EDTA buffer. Gels were dried and analyzed by exposure to a phosphorimaging screen (Molecular Dynamics, Sunnyvale, CA).
| Source | Binding Site | Sequence (5′ to 3′) | Reference | |||
|---|---|---|---|---|---|---|
| SP1 | ATTCGATCGGGGCGGGG CGAGC | 23 | ||||
| MHC | NF-κB | Wild-type: GGCTGGGGATT CCCCATCT | 24 | |||
| Mutant: GGCTGcGGATTCCg CATCT | ||||||
| IL-6 | NF-κB | Wild-type: TCAAATGTGGGA TTTTCCCAT | 25 | |||
| Mutant: TCAAATGTaatATTT TCCCAT |
The IL-6 promoter region corresponding to nucleotides −1223 to +11 was subcloned into pGL3 (Promega). Point mutations in the NF-κB binding motif were made using a modification of the PCR-uracil DNA-glycosylase (UDG) method (26, 27). Briefly, PCR primers spanning the mutation site were synthesized which replaced relevant bases with point mutations and with deoxyuracil-CE phosphoramidite in place of the thymidine-CE phosphoramidite (Cruachem, Sterling, VA). Plasmid containing the wild-type promoter insert was amplified in two corresponding sections using long distance PCR (Expand; Boehringer Mannheim). PCR products were digested at 37°C for 30 min with UDG to create cohesive ends which were allowed to anneal at room temperature prior to transformation. As a control for PCR errors, this process was also performed in reverse to convert the mutant NF-κB binding motif back to wild-type. All plasmid inserts were sequenced (UNC-CH Automated DNA Sequencing Facility, Chapel Hill, NC) for verification of insert and mutation. The pSV-β-Galactosidase (pSV-β-Gal) vector (Promega) containing the SV-40 early promotor and enhancer linked to lacZ was used as an internal positive control to monitor transfection efficiency.
BEAS-2B cells were plated in 12-well tissue culture dishes and grown to 70–80% confluence. Cells were transfected for 6 h with 0.2 μg pSV-β-Gal and 0.8 μg of the luciferase vector in the presence of 6 μg of the liposomal transfection reagent DOTAP (Boehringer Mannheim), and then cultured for 24 h in media alone. Cells were subsequently stimulated for 3 to 18 h with 10 ng/ml TNFα (R&D Systems, Minneapolis, MN) or 50 μg/ml ROFA. Cell lysates were harvested and analyzed sequentially for luciferase activity and β-galactosidase activity with a chemiluminescence assay kit (Tropix, Bedford, MA).
The software package Instat 2 (GraphPad, San Diego, CA) was used for statistical analyses. All data are expressed as mean ± SEM. One-tailed paired t tests were performed to compare gene expression in ROFA-exposed and unexposed cells, or to compare gene expression in cells exposed to ROFA with or without inhibitors. Significance was assumed at P < 0.05.
Recent work with primary airway epithelial cells demonstrates that mRNAs coding for several cytokines, including IL-6, are transcribed early after ROFA exposure (20). BEAS-2B cells exposed to similar ROFA concentrations also have elevated IL-6 mRNAs within 6 h after ROFA exposure (Figure 1). This is a transient response which returns to control values after 16 h, even in the continued presence of ROFA. In contrast, TNFα, a well-characterized activator of IL-6 in epithelial cells, induces a sustained expression of IL-6 mRNA lasting up to 24 h.

Fig. 1. ROFA induces expression of IL-6 mRNA in BEAS-2B cells. BEAS-2B cells were exposed to 50 μg/ml ROFA or to 10 ng/ml TNFα, which was used as a positive control. RNA was isolated 2, 6, 16, and 24 h after exposure and RT-PCR was performed with primers specific for IL-6 and the housekeeping gene GAPDH. This gel is representative of three experiments.
[More] [Minimize]As a measure of both constitutive and ROFA-induced NF-κB activity, electromobility shift assays (EMSAs) were first performed using the high-affinity NF-κB probe derived from the murine major histocompatibility complex (MHC). Nuclear extracts were prepared from BEAS-2B cells which were exposed to ROFA for 1 h, and the presence of specific NF-κB binding protein in the nucleus measured by EMSA. Control cultures did not exhibit measurable constitutive NF-κB activity (Figure 2A). However, ROFA induced the retardation of the NF-κB oligonucelotide probe as evidenced by the appearance of a major band (I) whose intensity increased with increasing ROFA concentration. A second minor band (II) was also present but its intensity was not affected by ROFA concentration. The appearance of both bands was blocked by competition with a 10-fold excess of unlabeled wild-type MHC NF-κB probe but not with a probe containing a mutation in the NF-κB binding site (Figure 2B). A third, nonspecific band appeared in both control and ROFA-treated cultures and was not affected by competition with unlabeled probe.

Fig. 2. ROFA induces nuclear protein binding to the MHC NF-κB motif. (A) Cells were exposed to 0, 6, 12, 25, or 50 μg/ml ROFA for 1 h and EMSAs were performed on 2 μg of nuclear extract. Arrows indicate ROFA-induced binding of nuclear protein to the 32P-labeled MHC NF-κB sequence. Both major (I) and minor (II) bands were observed. The third visible band represents nonspecific binding present in all lanes. (B) Cells were exposed to 50 μg/ml ROFA for 1 h and EMSAs were performed on 2 μg of nuclear extract. The appearance of bands I and II was inhibited by specific competition with a 10-fold excess of cold wild-type MHC sequence (lane 2) but not a 50-fold excess of a cold mutant MHC sequence (lane 1). The wild-type and mutant sequences are shown in Table 1. This gel is representative of 10 experiments. EMSAs run in parallel with the SP1 sequence verified that lanes were loaded equally (data not shown).
[More] [Minimize]Initiation of IL-6 transcription has been demonstrated to be activated by NF-κB binding to the consensus sequence found 137 bases upstream from the transcription start site in the IL-6 promoter. The IL-6–NF-κB sequence motif differs in sequence from the MHC NF-κB site (Table 1), does not have as high an affinity for NF-κB binding proteins as the MHC motif, and also contains different flanking sequences. In order to characterize further the role of NF-κB in ROFA-induced activation of the IL-6 gene, EMSAs were performed using a probe corresponding to the NF-κB sequence found in the IL-6 promoter. Cells were exposed to 50 μg/ml ROFA or 10 ng/ml TNFα (used as a positive control) for 1 h. As seen with the MHC probe, ROFA induced an increase in IL-6 NF-κB binding activity which appeared as a larger major band and a smaller minor band (Figure 3A). A similar increase occurred after TNFα stimulation. A probe matching the SP1 consensus sequence was run in parallel to normalize for variabilities in sample loading. ROFA-induced IL-6 NF-κB binding activity was specifically blocked by the addition of a 10-fold excess of unlabeled IL-6 NF-κB wild-type oligonucleotide probe, and was unaffected by a 10-fold excess of the nonspecific SP1 probe (Figure 3B).

Fig. 3. ROFA induces nuclear protein binding to the IL-6 NF-κB motif. (A) Cells were exposed to 50 μg/ml ROFA for 1 h and EMSAs were performed on 2 μg of nuclear extract. Binding to the IL-6 NF-κB sequence was increased above unexposed cells (lane 1) by both ROFA (lane 2) and TNF (lane 3), with a pattern of major (I) and minor (II) bands similar to that seen with the MHC sequence. Nuclear protein binding to the SP1 sequence remained unchanged after exposure and serves as a control for loading efficiency. (B) The appearance of bands I and II was inhibited by specific competition with a 10-fold excess of unlabeled IL-6 sequence (lane 5) but not the nonspecific SP1 sequence (lane 4). This gel is representative of 10 experiments. EMSAs run in parallel with the SP1 sequence verified that lanes were loaded equally (data not shown).
[More] [Minimize]Since NF-κB in the nucleus is found preferentially as a p50–p65 heterodimer, antibodies specific to each subunit were used to confirm the presence of both the p50 and p65 polypeptides in the DNA–protein complex. Pretreatment with the p50-specific antibody caused a shift in the minor band (Figure 4), and a shift in the major band was seen in samples pretreated with the p65-specific antibody. A combination of p50 and p65 antibodies effectively shifted both the major and minor bands. In contrast, no effect was seen with an antibody specific to cRel (another subunit within the NF-κB family of DNA-binding proteins). These data demonstrate that ROFA exposure induces an increase in NF-κB binding protein activity in the nucleus, presumably by activation and translocation of the p50–p65 heterodimer from the cytoplasm, and that these proteins can specifically bind to the NF-κB motif found in the IL-6 promoter.

Fig. 4. Translocated NF-κB binding to the IL-6 promoter consists primarily of p50 and p65 subunits. Cells were exposed to 50 μg/ml ROFA for 1 h and EMSAs were performed on 2 μg of nuclear extract. ROFA-induced NF-κB binding is shown in lane 1. Addition of an antibody to p50 (lane 2) results in a shift of the minor band, and an antibody to p65 (lane 3) causes a shift in the position of the major band. Antibody to cRel does not affect the migration of either band (lane 4), whereas a combination of p50 and p65 antibodies shifted both bands I and II (lane 5). This gel is a representative of six experiments.
[More] [Minimize]To demonstrate that ROFA-induced binding of NF-κB proteins to the NF-κB response element adjacent to the IL-6 gene actually results in activation of the gene, transient transfections were performed on BEAS-2B cells with a plasmid containing the 5′ promoter region from the IL-6 gene linked to a luciferase reporter gene. The promotor region contained either the wild-type or a mutant NF-κB sequence and a representation of the plasmid construct is shown in Figure 5. Cells transfected with plasmid containing either the wild-type or mutant NF-κB sequence were exposed to 50 μg/ml ROFA or 10 ng/ml TNFα for 18 h, a time previously shown to result in maximal IL-6 protein accumulation.

Fig. 5. IL-6 promoter region. The region from +11 to −1223, which includes the NF-κB site and the TATA box, was used for promoter reporter experiments (25). Mutation of the NF-κB site was accomplished by changing the initial recognition pattern of GGG to AAT.
[More] [Minimize]Exposure of BEAS-2B cells to ROFA for 18 h following transfection with a plasmid containing the wild-type NF-κB sequence resulted in a 270% increase in luciferase activity compared with activity measured in unexposed cells (Figure 6). TNFα stimulation produced a similar increase in luciferase activity. Control transfections using a plasmid containing the luciferase gene but no IL-6 promoter sequences did not show any increase in luciferase activity after TNFα stimulation, demonstrating that the luciferase response is being driven by the insertion of the IL-6 promoter (data not shown).

Fig. 6. Activation of NF-κB is necessary in part for IL-6 gene expression. BEAS-2B cells were transiently transfected with a plasmid containing the IL-6 promoter attached to the luciferase gene. Constructs contained a wild-type NF-κB sequence, a mutant NF-κB sequence, or a reversion from mutant to wild-type as described in Materials and Methods. Cells were subsequently exposed to 10 ng/ml TNF or 50 μg/ml ROFA for 18 h. Luciferase activity was measured, corrected for transfection efficiency relative to β-galactosidase activity, and expressed as a percent of unstimulated control. Control transfections using a plasmid containing the luciferase gene but no IL-6 promoter sequences did not show any increase in luciferase activity after TNFα stimulation, demonstrating that the luciferase response is being driven by the insertion of the IL-6 promoter (data not shown). Cells transfected without the IL-6 promoter and then exposed to ROFA demonstrated some luciferase activity, which was not statistically significant from unstimulated controls and was subtracted out of the ROFA values as background. Data represent the mean ± SEM of nine experiments. Lanes 1 and 3: cells transfected with plasmid containing wild-type NF-κB sequences; lanes 2 and 4: cells transfected with plasmid containing mutant NF-κB sequences; lane 5: cells transfected with plasmid containing revertant NF-κB sequences. Asterisks indicate values statistically different from controls (P ⩽ 0.01); crosses indicate values different from wild-type expression (P ⩽ 0.01).
[More] [Minimize]A point mutation of the NF-κB sequence motif in the IL-6 promoter resulted in complete abrogation of luciferase activity after TNFα stimulation. Cells exposed to ROFA had a substantial but incomplete reduction of luciferase activity. The use of PCR site-directed mutagenesis could have potentially introduced unintended base substitutions within critical regions of the IL-6 promoter or the luciferase reporter gene. In order to control for the possibility that the reduced luciferase response was the result of a nonspecific mutation, the NF-κB mutant plasmid was reverted back to wild-type by following the same procedure that was used to make the original mutation. This reversion restored the plasmid to wild-type activity in response to ROFA exposure, demonstrating that the NF-κB mutation is specific and reversible (Figure 6).
We have postulated that transition metals found in ROFA induce IL-6 production via reactive oxygen species (ROS) activation of NF-κB. To test this hypothesis BEAS-2B cells were pre-incubated with the metal chelator DEF or the free radical scavenger NAC prior to ROFA exposure. In order to avoid extended exposure of transfected cells to antioxidants, the ROFA exposure in these experiments was terminated after 3 h. Even at this early time point ROFA induced a 157% increase in luciferase activity in cells transfected with the wild-type IL-6 promoter (Figure 7). This response was effectively blocked by 1 mM DEF and 30 mM NAC. Mutation of the NF-κB site again resulted in a partial decrease in luciferase activity.

Fig. 7. IL-6 gene expression via NF-κB can be blocked by inhibitors of ROI and metal chelation. BEAS-2B cells were transiently transfected with a plasmid containing the IL-6 promoter containing wild-type or a mutant NF-κB sequence, as described in Materials and Methods. Cells were pretreated with inhibitors for 30 min and then exposed to 50 μg/ml ROFA for 3 h. Luciferase activity was measured, corrected for transfection efficiency relative to β-galactosidase activity, and expressed as a percent of unstimulated control. Inhibitors demonstrated no measurable effect on baseline IL-6 promoter activity (data not shown). Data represent the mean ± SEM of four experiments. Lanes 1, 2 and 3 represent cells transfected with plasmid containing wild-type NF-κB sequences and lane 4 represents cells transfected with plasmid containing mutant NF-κB sequences. Lane 2 also represents cells pretreated with DEF and lane 3 represents cells pretreated with NAC.
[More] [Minimize]Exposure of rats to ROFA results in an acute inflammatory reaction as evidenced by an influx of PMNs into the lung and increased amounts of protein in bronchoalveolar lavage fluid. Exposure of airway epithelial cells to ROFA in vitro results in the production of several proinflammatory mediators including PGE2, IL-6, TNF, and IL-8, which is the major PMN chemotactic and activating factor in the lung. The data presented in this study demonstrate that expression of one of these mediators, IL-6, is accompanied by activation of NF-κB protein, binding of this protein to specific sequences in the promoter of the IL-6 gene, and activation of the IL-6 gene itself. NF-κB activation is inhibited by the metal chelator DEF and the free radical scavenger NAC, suggesting that metal-induced oxidative stress may play a significant role in the initiation phase of the inflammatory cascade following particulate exposure.
Binding sites for the NF-κB/Rel family of transcription factors are found in the promoter and enhancer regions of a multitude of genes involved in the inflammatory response, including cytokines, chemokines, and growth factors. Transcriptional activation of specific inflammatory genes such as IL-1, IL-6, IL-8, and TNF is mediated by NF-κB in various cell types under a wide range of conditions (26, 27). In lung epithelial cells, nuclear translocation of NF-κB has been stimulated with IL-1, TNF (28, 29), phorbol esters (28, 30), and asbestos (31). Therefore, the nuclear translocation of NF-κB after ROFA exposure and its subsequent activation of IL-6 gene expression in BEAS-2B cells is consistent with the transcriptional activation of inflammatory genes via NF-κB by a variety of stressors.
Although we have shown that ROFA-induced IL-6 transcription after ROFA exposure is dependent on the presence of an intact NF-κB response element, mutation of this element does not completely block the IL-6 response, as occurs after TNF stimulation. This suggests that other factors may be involved. Regulation of the IL-6 gene is controlled by a complex network of regulatory elements including C/EBPα/(NFIL-6) (32), API (33), MRE (25), as well as NF-κB (25, 34-36). The NFIL-6 binding site is a likely candidate for interactive regulation with NF-κB because it has been shown to bind NF-κB subunits and interact synergistically with NF-κB in the IL-8 gene promoter (37, 38). AP1 has also been linked to IL-6 production in epithelial cells after UV light exposure (33). EMSAs of nuclear extracts from BEAS-2B cells demonstrate constitutive expression of AP1 and NFIL-6 binding activity, and ROFA exposure did not increase binding above the baseline level (data not shown). However, preliminary data suggest that if growth factors are removed from BEAS cells prior to ROFA exposure, baseline levels of AP1 binding activity are greatly diminished and ROFA can induce increased binding of nuclear protein to AP1 sites. However, functional experiments will be necessary to delineate the possible role of these DNA-binding proteins in basal and ROFA-induced IL-6 production. Further experiments may also identify alternative regulatory pathways such as post-transcriptional modulation of mRNA stability.
We have postulated that generation of ROS by transition metals is responsible for enhanced IL-6 production. In endothelial cells, the transition metals NiCl2 and CoCl2 have been shown to activate NF-κB as well as induce IL-6 expression (39). Indeed the production of ROS may be a common pathway by which many stimuli converge to initiate I-κB phosphorylation, resulting in the proteolytic degradation of I-κB and unmasking of the NF-κB nuclear translocation signal (40, 41). Antioxidants have been used in many systems to inhibit NF-κB activation (40). Consistent with these findings we have shown that pretreatment with the free radical scavenger NAC and the extracellular metal chelator DEF blocks ROFA activation of NF-κB and subsequent IL-6 mRNA transcription.
It is also possible that the activation of NF-κB by ROFA exposure is dependent on the production of other cytokines known to be activated by ROFA, such as TNF and IL-8 (20). IL-6 gene expression in fibroblasts and lymphoid cells is dependent on IL-1 and TNF (34, 35, 42). Indeed, we have previously shown that epithelial cells exposed to ROFA secrete TNF within 2 h following exposure (20). However, two lines of evidence argue against this possibility. First, we show here that a single hour of ROFA exposure is sufficient to activate NF-κB, and in another paper (44) we show that 5 min of ROFA exposure is sufficient to induce protein phosphorylation in these epithelial cells. In addition, mRNAs for both TNF and IL-6 are elevated within 2 h of ROFA exposure, the earliest time at which they were measured. These data indirectly support the idea that ROFA is acting rapidly to initiate protein phosphorylation (a required step in NF-κB activation) and that mRNAs and protein for IL-6 are elevated within 2 h of ROFA exposure. Second, the amount of TNF protein secreted by these cells 2 h after ROFA exposure is more than an order of magnitude less than that required to activate IL-6 secretion in them (unpublished data). While these two lines of evidence make it unlikely that the IL-6 response is mediated by TNF, we cannot absolutely exclude the possibility. It is possible that TNF or IL-1 production by other cell types may be relevant in vivo or that internal activation events (such as with IL-1) may be important.
Mobilization of inflammatory mediators plays a critical role in the pulmonary response to air pollutants such as ozone (43). In vitro and animal exposure models suggest that some particulate air pollutants also trigger an inflammatory response in the lung (13, 15). We have demonstrated that NF-κB, a common transcriptional activator of several inflammatory genes (26, 27), regulates IL-6 transcription in a lung epithelial cell line exposed to ROFA. IL-6 is a multifunctional cytokine activated early in the inflammatory response, chronically elevated in association with several environmentally induced respiratory diseases, and released in vitro by lung epithelial cells after ROFA exposure. These data are indicative of a common mechanistic pathway through which particulate air pollutants may lead to pulmonary inflammation and respiratory distress.
In this study, we used ROFA as a model of combustion-derived inorganic components found in particulate air pollution which may be associated with the health effects of PM10 inhalation. These experiments were specifically designed to test the hypothesis that transition metals present in particulate pollution can induce the expression of proinflammatory cytokines in airway epithelial cells via NF-κB mediated events, and are not meant to replicate concentrations that might be inhaled by humans breathing ambient air. Indeed, it would be nearly impossible to know with certainty how the doses of particles administered to cultured epithelial cells in this study relate to what respiratory tract epithelial cells might come in contact with in a person breathing ambient air. The distribution of ROFA within the atmosphere can vary by 1,000-fold and the size of fly ash particles is very heterogenous. In addition, the dosimetry of uptake, impaction, solubilization, and clearance is not well understood for these particles. However, the doses of ROFA received by our cultured cells are comparable to doses instilled into rats that cause inflammation and lung damage in vivo. Rats given 75 μg to 2.5 mg ROFA intratracheally exhibit a significant inflammatory response (13 and D. Costa, personal communication). The surface area of a rat's airway (including the terminole bronchioles) is approximately 5% of its lung surface area or 100 cm2. Assuming the majority of the instilled ROFA remains within this region, the average dose would be 0.75 to 25 μg/cm2 epithelial cell surface area. The dose of ROFA delivered to our cultured epithelial cells (which are in a monolayer similar to in vivo cells) was 16 μg/cm2, well within the dose range employed in animal studies.
This report has been reviewed by the National Health and Environmental Effects Research Laboratory, United States Environmental Protection Agency, and approved for publication. Approval does not signify that the contents necessarily reflect the views and policies of the Agency, nor does mention of trade names or commercial products constitute endorsement or recommendations for use.
| 1. | Dockery D. W., Pope C. A., Xu X., Spengler J. D., Ware J. H., Fay M. E., Ferris B. G., Speizer F. E.An association between air pollution and mortality in six U.S. cities. N. Engl. J. Med.32924199317531759 |
| 2. | Schwartz J.Air pollution and daily mortality: a review and meta analysis. Environ. Res.6419943652 |
| 3. | Dockery D. W., Speizer F. E., Stram D. O., Ware J. H., Spengler J. D., Ferris B. G.Effects of inhalable particles on respiratory health of children. Am. Rev. Respir. Dis.13931989587594 |
| 4. | Pope C. A.Respiratory disease associated with community air pollution and a steel mill, Utah Valley. Am. J. Public Health7951989623628 |
| 5. | Dockery D. W., Ware J. H., Ferris B. G., Speizer F. E., Cook N. R., Herman S. M.Change in pulmonary function in children associated with air pollution episodes. J. Air Pollut. Control Assoc.3291982937942 |
| 6. | Devlin, R. B., A. J. Ghio, and D. L. Costa. 1998. Responses of the lung to inhaled particles: inflammatory cell responses. In Particle Lung Interactions. P. Gehr and J. Heyder, editors. Marcel Dekker, New York. (In press) |
| 7. | U.S. Environmental Protection Agency. 1996. Air quality criteria for particulate matter. Publication No. EPA/600/P-95/1bF. Research Triange Park, NC. |
| 8. | Levy B. S., Hoffman L., Gottsegen S.Boilermakers' bronchitis: respiratory tract irritation associated with vanadium pentoxide exposure during oil-to-coal conversion of a power plant. J. Occup. Med.2681984567570 |
| 9. | Bright P., Burge P. S., O'Hickey S. P., Gannon P. F., Robertson A. S., Boran A.Occupational asthma due to chromium and nickel electroplating. Thorax52119972832 |
| 10. | Mastromatteo E.Nickel: a review of its occupational health aspects. J. Occup. Med.931967127136 |
| 11. | Lees R. E.Changes in lung function after exposure to vanadium compounds in fuel oil ash. Br. J. Ind. Med.3731980253256 |
| 12. | Pritchard R. J., Ghio A. J., Lehmann J. R., Winsett D. W., Tepper J. S., Park P., Gilmour M. I., Dreher K. L., Costa D. L.Oxidant generation and lung injury after particulate air pollutant exposure increase with the concentration of associated metals. Inhal. Toxicol.81996457477 |
| 13. | Dreher K. L., Jaskot R. H., Lehmann J. R., Richards J. H., McGee J. K., Ghio A. J., Costa D. L.Soluble transition metals mediate residual oil fly ash induced acute lung injury. J. Toxicol. Environ. Health501997285305 |
| 14. | U.S. Environmental Protection Agency. October 1993. National Air Pollutant Emission Trends, 1990–92. Office of Air Quality and Standards, Research Triange Park, NC. EPA-454/ R-93-032. |
| 15. | Hatch G. E., Boykin E., Graham J. A., Lewtas J., Pott F., Loud K., Mumford J. L.Inhalable particles and pulmonary host defense: in vivo and in vitro effects of ambient air and combustion particles. Environ. Res.36119856780 |
| 16. | Becker, S., J. M. Soukup, I. Gilmour, and R. B. Devlin. 1997. Stimulation of human and rat alveolar macrophages by urban air particulates: effects on oxidant radical generation and cytokine production. Toxicol. Appl. Pharmacol. (In press) |
| 17. | Standiford T. J., Kunkel S. L., Basha M. A., Chensue S. W., Lynch J. P., Toews G. B., Westwick J., Strieter R. M.Interleukin-8 gene expression by a pulmonary epithelial cell line: a model for cytokine networks in the lung. J. Clin. Invest.86199019451953 |
| 18. | Cromwell O., Hamid Z., Corrigan C., Barkans J. J., Meng Z., Collins P. D., Kay A. B.Expression and generation of interleukin-8, IL-6 and granulocyte-macrophage colony-stimulating factor by bronchial epithelial cells and enhancement by IL-1β and tumor necrosis factor-α. Immunology771992330337 |
| 19. | Devlin, R. B., K. P. McKinnon, T. Noah, S. Becker, and H. S. Koren. 1994. Ozone-induced release of cytokines and fibronectin by alveolar macrophages and airway epithelial cells. Am. J. Physiol. 266(6, Pt. 1):L612–L619. |
| 20. | Carter J. D., Ghio A., Samet J., Devlin R. B.Cytokine production by human airway epithelial cells after exposure to an air pollution particle is metal dependent. Toxicol. Appl. Pharmacol.1461997180188 |
| 21. | Vanhee D., Gosset P., Boitelle A., Wallaert B., Tonnel A. B.Cytokines and cytokine network in silicosis and coal worker's pneumoconiosis. Eur. Respir. J.81995834842 |
| 22. | Blanc P. D., Boushey H. A., Wong H., Wintermeyer S. F.Cytokines in metal fume fever. Am. Rev. Respir. Dis.1471993134138 |
| 23. | Baeuerle P. A., Henkel T.Function and activation of NF-kappa B in the immune system. Annu. Rev. Immunol.121994141179 |
| 24. | Schreck R., Albermann K., Baeuerle P. A.Nuclear factor kappa B: an oxidative stress-responsive transcription factor of eukaryotic cells (a review). Free Radic. Res. Commun.1741992221237 |
| 25. | Reddel R. R., Ke Y., Gerwin B. I., McMenamin M. G., Lechner J. F., Su R. T., Brash D. E., Park J. B., Rhim J. S., Harris C. C.Transformation of human bronchial epithelial cells by infection with SV40 or adenovirus-12 SV40 hybrid virus, or transfection via strontium phosphate coprecipitation with a plasmid containing SV40 early region genes. Cancer Res.48198819041909 |
| 26. | Smith C., Day P. J., Walker M. R.Generation of cohesive ends on PCR products by UDG-mediated excision of dU, and application for cloning into restriction digest-linearized vectors. PCR Methods Appl.241993328332 |
| 27. | Rashtchian A.Novel methods for cloning and engineering genes using the polymerase chain reaction. Curr. Opin. Biotechnol.6119953036 |
| 28. | Jany B., Betz R., Schreck R.Activation of the transcription factor NF-kappa B in human tracheobronchial epithelial cells by inflammatory stimuli. Eur. Respir. J.831995387391 |
| 29. | Ray K. P., Kennard N.Interleukin-1 induces a nuclear form of transcription factor NF kappa B in human lung epithelial cells. Agents Actions381993C61C63 |
| 30. | Newton R., Adcock I. M., Barnes P. J.Superinduction of NF-kappa B by actinomycin D and cycloheximide in epithelial cells. Biochem. Biophys. Res. Commun.21821996518523 |
| 31. | Janssen Y. M., Barchowsky A., Treadwell M., Driscoll K. E., Mossman B. T.Asbestos induces nuclear factor kappa B (NF-kappa B) DNA-binding activity and NF-kappa B-dependent gene expression in tracheal epithelial cells. Proc. Natl. Acad. Sci. USA9218199584588462 |
| 32. | Akira S., Kishimoto T.IL-6 and NF-IL6 in acute-phase response and viral infection. Immunol. Rev.12719922550 |
| 33. | Kick G., Messer G., Goetz A., Plewig G., Kind P.Photodynamic therapy induces expression of interleukin 6 by activation of AP-1 but not NF-kappa B DNA binding. Cancer Res.5511199523732379 |
| 34. | Libermann T. A., Baltimore D.Activation of interleukin-6 gene expression through the NF-kappa B transcription factor. Mol. Cell. Biol.105199023272334 |
| 35. | Shimizu H., Mitomo K., Watanabe T., Okamoto S., Yamamoto K.Involvement of a NF-kappa B-like transcription factor in the activation of the interleukin-6 gene by inflammatory lymphokines. Mol. Cell. Biol.1021990561568 |
| 36. | Ray A., LaForge K. S., Sehgal P. B.On the mechanism for efficient repression of the interleukin-6 promoter by glucocorticoids: enhancer, TATA box, and RNA start site (Inr motif) occlusion. Mol. Cell. Biol.1011199057365746 |
| 37. | Mukaida N., Mahe Y., Matsushima K.Cooperative interaction of nuclear factor-KB and cis-regulatory enhancer binding protein-like factor binding elements in activating the interleukin-8 gene by pro-inflammatory cytokines. J. Biol. Chem.26519902112821133 |
| 38. | Kinsch C., Lang R. K., Rosen C. A., Shannon M. F.Synergistic transcriptional activation of the IL-8 gene by NF-KB p65 (RelA) and NFIL-6. J. Immunol.1531994153163 |
| 39. | Goebeler M., Roth J., Brocker E. B., Sorg C., Schulze-Osthoff K.Activation of nuclear factor-kappa B and gene expression in human endothelial cells by the common haptens nickel and cobalt. J. Immunol.1555199524592467 |
| 40. | Schreck R., Rieber P., Baeuerle P. A.Reactive oxygen intermediates as apparently widely used messengers in the activation of the NF-kappa B transcription factor and HIV-1. EMBO J.108199122472258 |
| 41. | Pinkus R., Weiner L. M., Daniel V.Role of oxidants and antioxidants in the induction of AP-1, NFKB, and glutathione s-transferase gene expression. J. Biol. Chem.27119961342213429 |
| 42. | Zhang Y. H., Lin J. X., Vilcek J.Interleukin-6 induction by tumor necrosis factor and interleukin-1 in human fibroblasts involves activation of a nuclear factor binding to a kappa B-like sequence. Mol. Cell. Biol.107199038183823 |
| 43. | Devlin R. B., McDonnell W. F., Mann R., Becker S., House D. E., Schreinemachers D., Koren H. S.Exposure of humans to ambient levels of ozone for 6.6 hours causes cellular and biochemical changes in the lung. Am. J. Respir. Cell Mol. Biol.419917281 |
| 44. | Samet J. M., Stonehuerner J., Reed W., Devlin R. B., Dailey L. A., Kennedy T. P., Bromberg P. A., Ghio A. J.Disruption of protein tyrosine phosphate homeostasis in bronchial epithelial cells exposed to oil fly ash. Am. J. Physiol. (Lung Cell. Mol. Biol.)161997L426L432 |