Abstract
Rationale: The mouse model of bleomycin-induced lung injury offers an approach to study idiopathic pulmonary fibrosis, a progressive interstitial lung disease with poor prognosis. Progenitor cell–based treatment strategies might combine antiinflammatory effects and the capacity for tissue repair.
Objectives: To expand progenitor cells with reparative and regenerative capacities and to evaluate their protective effects on pulmonary fibrosis in vivo.
Methods: Prominin-1/CD133+ epithelial progenitor cells (PEPs) were expanded from adult mouse lungs after digestion and culture of distal airways. Lung fibrosis was induced in C57Bl/6 mice by instillation of bleomycin. Two hours later, animals were transplanted with PEPs. Inflammation and fibrosis were assessed by immunohistochemistry, bronchoalveolar lavage fluid differentials, and real-time polymerase chain reaction.
Measurements and Main Results: PEPs expanded from mouse lungs were of bone marrow origin, coexpressed stem and hematopoietic cell markers, and differentiated in vitro into alveolar type II surfactant protein-C+ epithelial cells. In bleomycin-challenged mice, intratracheally injected PEPs engrafted into the lungs and differentiated into type II pneumocytes. Furthermore, PEPs suppressed proinflammatory and profibrotic gene expression, prevented the recruitment of inflammatory cells, and protected bleomycin-challenged mice from pulmonary fibrosis. Mechanistically, the protective effect depended on upregulation of inducible nitric oxide synthase in PEPs and nitric oxide–mediated suppression of alveolar macrophage proliferation. Accordingly, PEPs from iNOS−/− but not iNOS+/+ mice failed to protect from bleomycin-induced lung injury.
Conclusions: The combined antiinflammatory and regenerative capacity of bone marrow–derived pulmonary epithelial progenitors offers a promising approach for development of cell-based therapeutic strategies against pulmonary fibrosis.
Lung injury activates tissue resident cells with regenerative capacity. Such cells might become of interest for designing novel cell-based therapies.
Prominin-1+ epithelial progenitors (PEPs) with antiinflammatory and regenerative capacity can be expanded from healthy mouse lungs. PEPs protect mice in a nitric oxide–dependent manner from bleomycin-induced pulmonary fibrosis.
Cell-based therapies might become a promising tool for the modulation of inflammatory processes and regeneration of damaged tissues (5). The lung exhibits a complex architecture with some regenerative capacity. Anatomically, the lung is divided in three main regions: proximal airways, distal airways, and alveolar space, which is composed of alveolar type I cells (>95%) and type II cells (<5%). The current view is that any of these regions contains a stem cell niche able to renew the local epithelial cell population after injury (6–10). Concerning the alveolar epithelium, type II pneumocytes are regarded as a stem cell–like population because of their capacity to proliferate and differentiate into type I cells after local injury (11). Unfortunately, type II pneumocytes are not sufficient to abrogate or prevent the progression of pulmonary disorders (12), suggesting that an exogenous source is necessary.
Bone marrow shows high plasticity and is believed to contribute to the homeostasis and repair of nonhematopoietic organs (13, 14). Recent data suggest that bone marrow–derived cells are involved in lung regeneration (15–17). Furthermore, it appears that the extent of tissue injury defines the capacity of bone marrow–derived cells to regenerate the pulmonary epithelium (15, 16, 18–20).
Prominin-1/CD133 is a recognized marker of hematopoietic stem cells and committed progenitors (21, 22) and is also expressed on adult epithelial cells (23, 24). Several lines of evidence suggest that prominin-1/CD133+ progenitor cells might be beneficial for treatment of several pathological disorders, including leukemia and cardiac and hepatic malignancies (25–28).
Herein we describe the expansion of high numbers of bone marrow–derived prominin-1/CD133+ epithelial progenitor cells (PEPs) from adult mouse lungs. These PEPs combined immunomodulatory and regenerative capacities and protected mice from the development of BLM-induced pulmonary fibrosis in a nitric oxide (NO)–dependent manner.
C57Bl/6 mice and C57Bl/6-green fluorescent protein (GFP) transgenic mice (GFP under the control of β-actin promoter) were purchased from Jackson Laboratory (Bar Harbor, ME) and housed in a specific pathogen-free environment. Inducible nitric oxide synthase (iNOS)−/− C57Bl/6 mice were kindly provided by Dr. Adrian J. Hobbs, Wolfson Institute for Biomedical Research, University College London, London. All animal experiments were conducted in accordance with institutional guidelines and Swiss federal law and were approved by the local authorities.
Five- to 7-week-old C57Bl/6 mice were lethally irradiated with two doses of 6.5 Gy using a Gammatron (Co-60) system and reconstituted with 2 × 107 donor bone marrow cells from C57Bl/6 GFP mice.
Seven- to 9-week-old male C57Bl/6 mice were anesthetized and intratracheally injected with 0.05 U/mouse of bleomycin (BLM) (Blenoxane, Axxora-Alexis, San Diego, CA) dissolved in 50 μl of sterile phosphate buffered saline (PBS). Control animals received the same volume of PBS. Two hours after PBS/BLM instillation, the animals received intratracheally either 2 × 105 PEPs resuspended in 50 μl of PBS or PBS alone.
Lungs of 7- to 9-week-old C57Bl/6 mice were perfused with 5 to 10 ml of ice-cold PBS, excised, separated from the trachea and the main bronchi, manually dissected into small pieces, and digested for 90 minutes at 37°C in 15 ml of GKN (11 mM d-glucose, 5.5 mM KCl, 137 mM NaCl, 25 mM Na2HPO4, 5.5 NaH2PO4·H2O) containing 10% fetal calf serum (FCS), 1.8 mg/ml collagenase type 4, and 0.1 mg/ml DNase I. The cell suspension was filtered through 70-μm nylon mesh and washed with GKN containing 10% FCS. Cells were resuspended in IMDM (Iscove's Modified Dulbecco's Medium, Gibco, Grand Island, NY) containing 2% FCS, 100 μM β-mercaptoethanol (Gibco), 100 U of penicillin, and 100 μg of streptomycin/ml (Pen/Strep, Gibco), 2mM L-glutamine, 25 mM N-2-hydroxyethylpiperazine -N′-ethane sulfonic acid, and plated at 5 × 106 cells into 6-cm diameter tissue culture dishes. Culture of lung homogenates gave rise to two main populations consisting of a round cell population and a fibroblast-like cell population that worked as a feeder layer. Cells were incubated at 37°C in a humidified atmosphere containing 5% CO2. The medium was changed two to three times a week. Nonadherent cells were removed 48 to 72 hours after plating. After 3 to 4 weeks cells were removed, washed, stained for 30 minutes at 4°C with an anti–prominin-1-PE antibody (eBiosciences, San Diego, CA) (1:200) and isolated using anti-PE antibodies coupled to magnetic beads (Miltenyi Biotec, Bergisch Gladbach, Germany) (purity > 95%). For alveolar epithelial cell differentiation, PEPs were cultured on 0.2% gelatin-coated cover slips in the presence of modified Small Airway Growth Medium (SAGM) (29) consisting of a basal medium (Small Airway Basal Medium, Cambrex, East Rutherford, NJ) supplemented with 0.5 mg/ml bovine serum albumin, 0.5% FCS, insulin/transferrin/selenium (ITS) supplement, 30 μg/ml bovine pituitary extract, 0.5 μg/ml epinephrine, 6.5 ng/ml triiodothyronine, 0.1 ng/ml retinoic acid, 0.5 μg/ml hydrocortisone, and 1 ng/ml epidermal growth factor (EGF).
Cells were filtered through 70-μm nylon mesh, stained for 30 minutes on ice with the appropriate antibodies, and analyzed on a CyAN ADP (Dako-Cytomation, Carpinteria, CA) using FlowJo 8.7.3 software (TreeStar, Ashland, OR). The following antibodies and dilutions were used: Primary antibodies: anti–prominin-1-PE 1:200 (eBioscience), anti–CXCR4-FITC 1:200 (BD Bioscience, San Jose, CA), goat anti–Sca-1 1:100 (R&D Systems, Abingdon, UK), biotin anti–c-kit 1:200, biotin anti-CD34 1:200, biotin anti-CD45 1:200 (eBioscience). Secondary antibodies: Alexa Fluor 488 donkey anti-goat IgG, 1:200 (Molecular Probes, Carlsbad, CA), and streptavidin-APC 1:200 (BD Bioscience).
Cells were cultured on gelatin-coated cover slips and fixed with 4% paraformaldehyde in PBS for 20 minutes at room temperature. After blockade of nonspecific binding with 10% FCS, cells were stained for 1 hour at 37°C with the appropriate primary and secondary antibodies. Prior to staining with collagen I, surfactant protein-C, and β-tubulin IV antibody, cells were washed with 0.2% saponin. Frozen sections were first stained with appropriate antibodies and then fixed. The following primary antibodies were used: anti–prominin-1-PE 1:200 (eBioscience), anti–CD45 FITC 1:200 (BD Bioscience), rabbit polyclonal anti–surfactant protein-C 1:400 (SP-C, Chemicon, Temecula, CA), rabbit anti-collagen I 1:400 (Rockland, Gilbertsville, PA), and mouse anti–β-tubulin IV 1:400 (Sigma, St. Louis, MO). The secondary antibodies Green-fluorescent Alexa Fluor 488 rabbit anti-GFP, Alexa Fluor 488 chicken anti-rabbit, and Alexa Fluor 488 goat anti-mouse (Molecular Probes) were used at a 1:200 dilution.
Animals were killed on selected days after BLM instillation. Lungs were perfused, removed, fixed in 4% formaldehyde, and stained with hematoxylin and eosin and/or Masson's trichrome stain to visualize collagen depositions.
Mice were killed by intra-peritoneal Pentothal injections (Abbott, North Chicago, IL). The trachea was exposed and bronchoalveolar lavage fluid (BALF) was obtained by three instillations of 1 ml of ice-cold PBS. BALF was centrifuged, resuspended in 100 μl of PBS, cytospun onto slides, Diff-Quik stained (according to the manufacturer's protocol), and analyzed under a light microscope.
Blood was collected via the inferior vena cava after opening the body cavity. A 1-ml syringe containing EDTA was used to bleed the mice. Cells were separated from erythrocytes using Lympholyte-M (Cedarlane Laboratories Ltd, Hornby, Canada) according to the manufacturer's instructions.
BALFs from several mice were pooled and centrifuged at 300 × g for 10 minutes. The resulting pellet was resuspended in RPMI-1640 medium supplemented with 10% FCS and incubated for 1 hour at room temperature on 10-cm diameter plastic dishes. Nonadherent cells were washed off with PBS and the adherent macrophages were collected.
PEPs were purified using magnetic beads, irradiated (2,000 rad) and cultured in 96-well plates in the presence of alveolar macrophages at a ratio of 1:2. Cells were stimulated for 24 hours with LPS (0.1 μg/ml) and IFN-γ (50 ng/ml). [3H]Thymidine incorporation was measured as a readout for proliferation. Nitrite (NO2−) levels reflecting NO production in culture supernatants were assessed using the Griess Reagent System (Promega, Madison, WI).
RNA was isolated using Trizol (Invitrogen, Carlsbad, CA) from total lung tissue according to the manufacturer's recommendations. First strand cDNA synthesis was performed as follows: RNA (2 μg) was incubated with oligo(dT)18 for 5 minutes at 70°C and chilled on ice. Reaction buffer (5×) 10 mM 4dNTP mix, RNase inhibitors, and RevertAID M-MuLV Reverse Transcriptase (Fermentas, St. Leon-Rot, Germany) were added and the reaction mixture was incubated for 60 minutes at 42°C. For real-time polymerase chain reaction (RT-PCR) the following primers were used: AQP5 Fw 5′-GGC CAC ATC AAT CCA GCC ATT A-3′, Rw 5′-GGC TGG GTT CAT GGA ACA GCC-3′; β-tubulin Fw 5′-GGA ACA TAG CCG TAA ACT GC-3′, Rw 5′-TCT ACT GTG CCT GAA CTT ACC-3′; CC10 Fw 5′-CGC CAT CAC AAT CAC TGT GGT CA-3′, Rw 5′-GAG GGT ATC CAC CAG TCT CTT CA-3′; E-cadherin Fw 5′-ACG TAT CAG GGT CAA GTG CC-3′, Rw 5′-CCT GAC CCA CAC CAA AGT CT-3′; Islet-1 Fw 5′-GTT TGT ACG GGA TCA AAT GC-3′, Rw 5′-ATG CTG CGT TTC TTG TCC TT-3′; Keratin 5 Fw 5′-ACC CTT GTT CCA CGG AAT GCA A-3′, Rw 5′-AAA GCA CAG TTA AGA CCA GAA AC-3′; Nanog Fw 5′-AGG GTC TGC TAC TGA GAT GCT CTG CA-3′, Rw 5′-CAA CCA CTG GTT TTT CTG CCA CCG-3′; Oct4 Fw 5′-GTG GAT TCT CGA ACC TGG CT-3′, Rw 5′-GTC TCC AGA CTC CAC CTC AC-3′; SP-C Fw 5′-TAT GAC TAC CAG CGG CTC CT-3′, Rw 5′-GTT TCT ACC GAC CCT GTG GA-3′. The primers used for quantitative RT-PCR are listed in Table 1. RT-PCR was performed using a 7,500 Fast RT-PCR System (Applied Biosystems, Foster City, CA) in the presence of SYBR-green (Applied Biosystems); glyceraldehyde-3-phosphate dehydrogenase was used as internal control. Amplification conditions were as follows: 50°C (2 min); 95°C (10 min); 95°C (15 s), 60°C (1 min), 40 repetitions. Specificity of each reaction was ascertained by performing the Melt procedure (60–95°C; 1°C/15 s) after completion of the amplification protocol, according to the manufacturer's instructions. Relative gene expression was analyzed using the 2−ΔΔCt method.
Gene Product | Forward Primer | Reverse Primer |
|---|---|---|
| GAPDH | CCTGCACCACCAACTGCTTA | TCATGAGCCCTTCCACCATG |
| iNOS | CAGCTGGGCTGTACAAACCTT | TGAATGTGATGTTTGCTTCGG |
| IL-4 | ACAGGAGAAGGGACGCCAT | GAAGCCCTACAGACGAGCTCA |
| IL-6 | TGTATGAACAACGATGATGCACTT | GGTACTCCAGAAGACCAGAGGAAAT |
| IL-13 | CGCAAGGCCCCCACTAC | AAAGTGGGCTACTTCGATTTTGG |
| IFN-γ | TGGAGGAACTGGCAAAAGGAT | GCCTGATTGTCTTTCAAGACTTCAA |
| TNF-α | CCCAGACCCTCACACTCAGATC | CCTCCACTTGGTTTGCT |
| CCL2 | CATCACTGAAGCCAGCTCTCTCT | GCAGGCCCAGAAGCATGA |
| MIP-1α | TTTTGAAACCAGCAGCCTTTG | TCTTTGGAGTCAGCGCAGATC |
| MCP-5 | AGAATCACAAGCAGCCAGTGTC | GTCAGCACAGATCTCCTTATCCAGT |
| TGF-β1 | CAACGCCATCTATGAGAAAACC | AAGCCCTGTATTCCGTCTCC |
| Fibronectin | TACCAAGGTCAATCCACACCCC | CAGATGGCAAAAGAAAGCAGAGG |
| Col-I | GATGACGTGCAATGCAATGAA | CCCTCGACTCCTACATCTTCTGA |
| SDF-1α | CGTGAGGCCAGGGAAGAG | TGATGAGCATGGTGGGTTGA |
| CCL21/SLC | GGCAAAGAGGGAGCTAGAAAACA | TGGACGGAGGCCAGCAT |
| MMP-9 | CCTGGAACTCACACGACATCTTC | TGGAAACTCACACGCCAGAA |
| KC/CXCL1 | TGCACCCAAACCGAAGTCAT | GGAGCTTCAGGGTCAAGGC |
Normally distributed data, such as proliferation responses and cytokine levels, were compared using the Student t test. Statistical analysis was conducted using Prism 4 software (GraphPad Software). P < 0.05 was considered to be statistically significant.
Several lines of evidence suggest that activation of tissue resident progenitor cells represents an injury-triggered process (9, 10). Thus, we hypothesized that dissection of pulmonary tissue creates a specific “injured” microenvironment that can promote the expansion of progenitor cells with a lung-specific differentiation capacity. In fact, the culture of lung homogenates gave rise to a population of small, round, semi-attached cells, growing on a feeder layer (Figures 1A and 1B). FACS analysis revealed that the vast majority of these round cells expressed prominin-1, stem cell antigen (Sca-1) (Figure 1E), c-kit (CD117) (Figure 1F), chemokine receptor type 4 (CXCR4) (Figure 1G), as well as the hematopoietic antigen CD45 (Figure 1H), but not CD34 (Figure 1I). PEPs were then purified by cell sorting and further analyzed. RT-PCR revealed that PEPs were negative for bronchial (Clara Cell 10-kd protein, CC10), alveolar type I (aquaporin-5, AQP5), alveolar type II (surfactant protein-C, SP-C), and epithelial (E-cadherin and keratin 5, K5) genes, but expressed genes characteristic for stem and progenitor cells (Islet-1, Nanog, but not Oct4) (Figure 1D). Of note, sorted prominin-1+/GFP+ cells do not grow on feeder layers from other organs or on embryonic fibroblasts (i.e., 3T3 cells) (see Figure E1 in the online supplement).
Figure 1. Characterization of prominin-1+ epithelial progenitors (PEPs). (A) Passage 0 cultures exhibit a rounded, semi-adherent cell population growing on feeder layer cells. (B) Immunohistochemistry showed that all round cells were positive for prominin-1 (red). 4′,6-diamidino-2-phenylindole (DAPI, blue) was used to visualize cell nuclei. (C) Culture of cells expanded from green fluorescent protein (GFP) chimeric lung demonstrated that nearly all prominin-1+ cells were GFP positive. Bars = 30 μm. (D) Real-time polymerase chain reaction showed no expression of lung epithelial markers (CC10, surfactant protien-C, AQP5, keratin-5, E-cadherin); in contrast, expression of genes characteristic for stem and progenitor cells (Islet-1, Nanog) was detected. cDNA from mouse embryonic stem cells was used as positive control in the right panel. (E–I) Fluorescence Activated Cell Sorting analysis of cell cultures. (E) Prominin-1+ cells coexpressed with Sca-1, (F) c-kit, (G) CXCR4, and (H) CD45, (I) but not CD34.
[More] [Minimize]All prominin-1+ cells coexpressed hematopoietic markers. To confirm the bone marrow origin of these cells, mice were lethally irradiated and reconstituted with bone marrow cells from GFP+ transgenic mice. Three weeks after bone marrow transplantation, we dissected lung tissues and expanded prominin-1+ lung-derived progenitors as described. As illustrated in Figure 1C, nearly all prominin-1+ cells were GFP positive (Figure 1C), indicating clearly that PEPs are of bone marrow origin.
We next addressed the potential of prominin-1+ progenitors to differentiate into an epithelial phenotype. To induce alveolar epithelial differentiation, sorted PEPs were cultured for 2 weeks in modified SAGM (29). Immunofluorescence microscopy showed that PEPs acquired the expression of surfactant protein-C (SP-C) (Figure 2B), which is specific for pulmonary type II cells, but lose the expression of prominin-1 (Figure E2). RT-PCR confirmed the expression of SP-C, but not of CC10 and AQP5, which are characteristic for bronchial and alveolar type I epithelial cells, respectively (Figure 2D). GFP+ PEPs expanded from lungs of chimeric mice exhibited a similar capacity to differentiate into type II epithelial cells in vitro (Figure 2C).
Figure 2. Prominin-1+ epithelial progenitors (PEPs) differentiate into alveolar type II epithelial cells in vitro and in vivo. (A) Phase contrast micrograph of prominin-1+ cells incubated for 2 weeks in Small Airway Growth Medium, and (B) stained for surfactant protein-C (SP-C, red). (C) In vitro differentiation of prominin-1+/green fluorescent protein (GFP)+ cells expanded from chimeric lungs. (D) Real-time polymerase chain reaction confirmed expression of surfactant protein-C (SP-C) type II cell-specific gene, but no other lung epithelial genes. (E–J) Intratracheal injection of GFP+ PEPs. (E–G) GFP+ cells were detected only in alveolar walls after 1 day, and (H–J) differentiated into SP-C–positive type II alveolar epithelial cells after 7 days. SP-C (red), GFP (green), 4′,6-diamidino-2-phenylindole (DAPI, blue). Bars = 30 μm.
[More] [Minimize]To address the differentiation capacity of PEPs in vivo, sorted prominin-1+/GFP+ cells were intratracheally delivered into C57Bl/6 mice after BLM instillation. At Day 1 after delivery, GFP+ cells were detected in the alveolar walls only and were negative for SP-C (Figures 2E–2G). In contrast, 7 days after delivery most GFP+ cells expressed SP-C (Figures 2H–2J). GFP+/SP-C+ cells corresponded to 1.71 ± 0.43% out of the total amount of SP-C+ cells. Importantly, GFP+ cells did not engraft into the alveolar epithelium of unchallenged animals (data not shown).
Taken together, these findings clearly demonstrate that PEPs have the capacity to differentiate into type II pneumocytes in vitro and in vivo.
We next addressed the presence of prominin-1+ cells within the healthy mouse lung. Distal airways were isolated from adult mice and digested as described. FACS analysis revealed that the percentage of prominin-1+ cells correspond to 10.41 ± 0.98% (Figure 3B); prominin-1+ cells were then stained for CD45 antibody. Analysis of samples showed that among the prominin-1+ subset, 6.82 ± 0.31% were coexpressing CD45 (Figure 3C). Collectively, the percentage of prominin-1+/CD45+ cells in the adult mouse lungs corresponds to 0.71 ± 0.08%. In addition, staining of frozen sections confirmed the presence of two different cell phenotypes in the adult lung. In fact, rare, single round prominin-1+ cells were detected in the alveolar epithelium (Figure 3D, asterisk), differently located from prominin-1+ cells sited along the bronchial epithelium (Figure 3D, arrows) (see Figure E3 for negative control).
Figure 3. Characterization of prominin-1+ cells in mouse lungs. (A–D) Fluorescence Activated Cell Sorting analysis of adult mouse lungs. (B) Prominin-1+ cells were gated and (C) stained for CD45. The percentage of prominin-1+/CD45+ cells within lungs corresponded to 0.71 ± 0.08 (n = 3). (FL1 = unstained; Iso = isotype control). (D) Immunohistochemistry on frozen sections confirmed the presence of two prominin-1+ distinct cell phenotypes located in the bronchial epithelium (white arrows) and alveolar epithelium (asterisk). (E–G) Prominin-1+ cells located in the alveolar epithelium were negative for surfactant protein-C (SP-C), (H–J) but were all coexpressing CD45. (K) Prominin-1 was also expressed on the apical surface of bronchial epithelial cells (H–I) coexpressing β-tubulin IV. Prominin-1 (red), SP-C (green, F, G), CD45 (green, I, J), β-tubulin IV (green, L, M), 4′,6-diamidino-2-phenylindole (DAPI, blue). Bars = 20 μm.
[More] [Minimize]Next, we performed further stains on frozen sections to characterize the two prominin-1–expressing populations. As shown, round prominin-1+ cells were detectable only in the alveolar epithelium, but they were all negative for type II–specific marker SP-C (Figures 3E–3G) and for type I marker AQP5 (data not shown). In addition they were all coexpressing CD45 (Figures 3H–3J). The second subset of prominin-1+ cells was found in the bronchial epithelium and the expression was restricted on the apical surface (Figure 3K). As shown in Figures 3L–3M, these cells were all coexpressing β-tubulin IV, which stains for cilia and is specifically expressed on bronchial epithelial cells.
To confirm that epithelial progenitor cells specifically expanded from the hematopoietic prominin-1+ population, we sorted ex vivo prominin-1+/GFP+ cells from chimeric mice and cultured them on a lung tissue–derived feeder layer. Up to 10 GFP+ cells were cultured with 5 × 105 feeder layer cells (Figures 4A–4C). Single prominin-1+/GFP+ cells expanded and gave rise to colonies (Figure 4D). Transfer of prominin-1+/GFP+ cells into SAGM resulted in their differentiation into type II alveolar epithelial-like cells expressing SP-C (Figures 4E–4G). Prominin-1+/GFP+ cells sorted from blood did not expand and did not give rise to colonies (Figure E4).
Figure 4. (A–C) Prominin-1+/GFP+ cells sorted from chimeric mice were plated with 5 × 105 feeder layer cells (D) and expanded. (E–G) After expansion, green fluorescent protein (GFP)+ cells were incubated for 2 weeks in the presence of Small Airway Growth Medium and differentiated into surfactant protein-C (SP-C)–positive cells. SP-C (red), GFP (green), 4′,6-diamidino-2-phenylindole (DAPI, blue). Bars = 30 μm.
[More] [Minimize]At Day 7 after intrapulmonary delivery of GFP+ PEPs into BLM-challenged mice (Figures 2E–2K), alterations in the alveolar epithelial architecture, typically affected after BLM treatment, were not evident. Given this observation, we set out to specifically address the reparative and protective capacity of PEPs in the BLM model. Figures 5A, 5D, and 5G illustrate the architecture of the alveolar epithelium in unchallenged, PBS-injected mice (control). In BLM-challenged mice intratracheally injected with PBS the alveolar epithelium was massively damaged with extensive collagen deposition and progressive fibrosis (Figures 5B, 5E, 5H). In contrast, intratracheal delivery of PEPs to BLM-challenged mice resulted in the preservation of an almost completely normal architecture of the alveolar epithelium for up to at least 21 days (Figures 5C, 5F, 5I). Administration of PEPs into BLM-challenged mice also protected from progressive loss of body weight (Figure 5J).
Figure 5. Effect of prominin-1+ epithelial progenitors (PEPs) injection on bleomycin (BLM)-induced lung fibrosis in mice. Hematoxylin and eosin (H&E)–stained histopathological sections from lungs of C57Bl/6 mice 21 days after either (A, D) saline exposure, (B, E) BLM exposure, or (C, F) BLM exposure and PEPs. (G, H, I) Masson's Trichrome staining of lung sections from the same experimental groups. Original magnification: ×25 (H&E) and ×200 (H&E and Trichrome). Data are representative of at least five mice per condition. (J) Body weight measurement from the same groups. (K) The number of total cells in bronchoalveolar lavage fluid of the three groups at Day 3 and Day 7. (L) Quantitative real-time polymerase chain reaction on lungs collected at the peak of inflammation (Day 7) and (M) at the fibrotic stage (Day 21) after BLM instillation; the panels summarize the quantitative results after normalization to the glyceraldehyde-3-phosphate dehydrogenase signal. Bars represent mean ± SD (n = 3).
[More] [Minimize]Importantly, whereas BALF samples taken at Days 3 and 7 from BLM-treated control mice injected with PBS only had increased numbers of total cells, samples taken from BLM-challenged mice injected with PEPs did not (Figure 5K and Table 2). RT-PCR analysis of Day 7 lung samples from PEP-treated mice showed no upregulation of IL-4, IL-6, IL-13, and TNF-α, nor of the chemokines KC, CCL2, MIP-1α, and MCP-5 mediating inflammatory cell recruitment (30, 31) (Figure 5L). Profibrotic genes, such as TGF-β1, and genes of cytokines mediating fibrocytes recruitment, such as SDF-1α or CCL21 (32, 33), were also not upregulated in PEP-treated animals at Day 21 (Figure 5M). Accordingly, FACS analysis on blood samples revealed that the number of circulating fibrocytes (CD45+/Col I+/CXCR4+) did not increase in mice that had received PEPs (Figure E5).
Parameter | PBS Day 3 (n = 3) | BLM Day 3 (n = 3) | BLM + PEPs Day 3 (n = 3) | PBS Day 7 (n = 3) | BLM Day 7 (n = 3) | BLM + PEPs Day 7 (n = 3) |
|---|---|---|---|---|---|---|
| Total (×106) | 0.251 ± 0.036 | 0.630 ± 0.144 | 0.261 ± 0.067 | 0.270 ± 0.040 | 1.145 ± 0.163 | 0.343 ± 0.005 |
| Neutrophils | 0.002 ± 0.002 | 0.278 ± 0.083 | 0.006 ± 0.003 | 0.003 ± 0.002 | 0.450 ± 0.147 | 0.011 ± 0.008 |
| Lymphocytes | 0.004 ± 0.003 | 0.076 ± 0.028 | 0.007 ± 0.002 | 0.005 ± 0.001 | 0.177 ± 0.036 | 0.027 ± 0.007 |
| Macrophages | 0.245 ± 0.034 | 0.276 ± 0.035 | 0.248 ± 0.050 | 0.262 ± 0.039 | 0.518 ± 0.009 | 0.305 ± 0.042 |
Similarly, mice that received bleomycin intraperitoneally followed by intratracheal injections of PEPs, showed markedly less fibrosis and displayed significant reduction of the collagen content in the lung. Control mice treated with PBS on the other hand developed significantly more lesions and showed higher collagen deposition and more thickened epithelium (Figure E6).
Taken together, these results indicate that intratracheal administration of PEPs specifically prevents the recruitment of inflammatory cells, abnormal extracellular matrix remodeling, and pulmonary fibrosis in BLM-challenged mice.
To specifically address the mechanism whereby PEPs mediate suppression of BLM-induced fibrosis, we focused on the early stages of disease development in this injury model. We compared the expression of various pro- and antiinflammatory genes in Day 1 lungs of control PBS-treated mice, and BLM-challenged mice treated or not with PEPs (Figure 6A). Lungs of PEPs-treated mice did not show an upregulation of IL-4 and IL-13. Importantly, lungs of PEPs-treated mice also did not display upregulation of KC/CXCL1 and CCL2, chemokines mainly produced by macrophages, which are considered as key players for the onset of pulmonary fibrosis in the BLM-induced injury model (31). However, BLM-challenged mice injected with PEPs showed significant upregulation of iNOS (Figure 6A). Current evidence suggests a regulatory effect of NO in many cell types (34–37) and a protective role in various lung disease models (38–40). To clarify whether PEPs or AMs were major NO producers, and to specifically assess effects of PEPs on the proliferation of AMs, we performed coculture experiments. As illustrated in Figure 6B, the proliferation of AMs was dramatically reduced when cultured in the presence of PEPs. PEPs-induced suppression of AM proliferation required cell-to-cell contact between AMs and PEPs (Figure 6D). Compared with individual cultures of AMs or PEPs, NO release was markedly increased in the supernatant of AM and PEPs cocultures (Figure 6C). To evaluate the role of NO in growth arrest, we first assessed proliferation responses in the presence of the nonspecific NO synthase inhibitor l-NAME. As shown in Figure 6E, addition of l-NAME neutralized the effect of PEPs and restored AM proliferation capacity. We next expanded PEPs from iNOS-deficient mice and cocultured them with AMs. iNOS−/− PEPs did not suppress the proliferation of AMs in vitro (Figure 6B). NO levels increased only in cocultures of AMs with iNOS+/+, but not iNOS−/− PEPs (Figure 6C), confirming that NO was produced specifically by PEPs. It is noteworthy that NO production did not differ between irradiated and nonirradiated PEPs (data not shown). Taken together, our findings suggest that PEPs directly inhibit the proliferation of AMs, which are critical for disease development in the BLM-induced lung injury model (31). In addition, our in vitro data argue for a critical role of NO in regulation of AM proliferation.
Figure 6. (A) Real-time polymerase chain reaction performed on lungs of mice challenged with phosphate-buffered saline (PBS), bleomycin (BLM) alone, or BLM + prominin-1+ epithelial progenitors (PEPs). (B) Proliferation of alveolar macrophages (AMs) is suppressed in the presence of inducible nitric oxide synthase (iNOS)+/+ PEPs but not in the presence of iNOS−/− PEPs. (C) Nitrite levels reflecting NO production in culture supernatants increase when AMs are cultured in the presence of iNOS+/+ PEPs but not in the presence of iNOS−/− PEPs. (D) The suppressive effects of PEPs require close contact to AMs. (E) Inclusion of the NOS inhibitor l-NAME, but not its inactive enantiomer d-NAME, restores proliferation of AMs in the presence of PEPs. [3H]-Thymidine incorporation was measured as the readout for proliferation. Bars represent mean ± SD (n = 3). *P < 0.01.
[More] [Minimize]To address the role of iNOS and NO in the PEPs-mediated suppression of BLM-induced lung injury in vivo, we injected BLM-challenged mice with either iNOS+/+ or iNOS−/− prominin-1+ cells. BALF was collected at Day 7. The number of total cells in BALF from mice injected with iNOS+/+ PEPs was comparable to the BALF of mice challenged with PBS only (Figure 7A). However, BALF from BLM-challenged mice injected with iNOS−/− PEPs contained a markedly increased number of total cells. Hematoxylin and eosin and Masson's Trichrome staining of lung sections from iNOS−/− PEPs-treated animals revealed the presence of inflammatory foci and collagen deposition (Figures 7E, 7I, 7M), comparable to that in lungs from BLM-challenged mice (Figures 7C, 7G, 7K). Importantly, mice that received other NO-producing cells, such as bone marrow–derived macrophages or bone marrow–derived dendritic cells, were not protected from pulmonary fibrosis (Figure E7).
Figure 7. (A) Intratracheal injection of inducible nitric oxide synthase (iNOS)−/− PEPs does not protect from bleomycin (BLM)–induced pulmonary fibrosis. The total cell number in bronchoalveolar lavage fluid (BALF) is comparable in mice injected with BLM alone and BLM + iNOS−/− PEPs. The total number of cells is similar in BALF from mice exposed to saline buffer or BLM + iNOS+/+ PEPs. *P < 0.01. Bars represent mean ± SD (n = 3). Lungs were harvested, sectioned, and stained with (B–I) hematoxylin and eosin (H&E) or (J–M) Masson's trichrome. Photomicrographs are representative of at least five mice per condition. Original magnification: ×25 (H&E) and ×200 (H&E and Trichrome).
[More] [Minimize]In conclusion, bone marrow–derived PEPs expanded from mouse lungs possess regenerative capacity and striking antiinflammatory properties, and protect BLM-treated mice from pulmonary fibrosis in an NO-dependent manner.
This study has identified a population of prominin-1/CD133+ bone marrow–derived epithelial progenitors with antiinflammatory properties and regenerative capacity from adult mouse lungs.
In support of the hypothesis that lung injury exceeding a certain threshold is necessary to activate stem/progenitor cell expansion, we found that dissection of pulmonary tissue resulted in the expansion of a small, round, undifferentiated population of prominin-1+ cells growing on a feeder layer. Recent studies have shown the presence of stem cell populations within lungs (9, 41). Our sorted prominin-1+/CD45+ cells were negative for SP-C and CC10. Accordingly, they represent a distinct subset from bronchioalveolar stem cells (9). Furthermore, our PEPs were of hematopoietic origin and clearly expressed a phenotype different from the bronchioalveolar stem cells and lung side population mesenchymal stem cells described by Summer and colleagues (41).
We have demonstrated that the healthy mouse lungs displayed two distinct prominin-1+ cell phenotypes. We identified for the first time the presence of a population of prominin-1+/CD45+ cells within the adult mouse lung. On the other hand, the majority of prominin-1+ cells belonged to the bronchial epithelial ciliated population. Prominin-1/CD133 expression has been already found on different adult epithelial cells (22). Our findings are consistent with recent work of Shmelkov and collaborators (24) demonstrating the presence of prominin-1+ cells along the bronchial epithelium. Notably, prominin-1+/GFP+ cells sorted from chimeric lungs expanded only in the presence of a feeder layer from GFP-negative cultures, but not in presence of other feeder layers including embryonic fibroblasts. This observation suggests that expansion of bone marrow–derived PEPs is specifically triggered by lung-derived cells. On the other hand, it was not possible to expand in vitro prominin-1+ cells isolated from mouse blood under the same conditions. These records clearly exclude that PEPs expanded from lungs could represent a residual of blood cells.
PEPs differentiated in vitro into type II epithelial cells. Based on their expression of type II alveolar specific gene SP-C, but not bronchial epithelial CC10, PEPs may represent a specific early committed alveolar progenitor population. In support of this notion, intratracheal injection of PEPs in BLM-challenged mice resulted in straight differentiation toward a type II epithelial phenotype. These data underscore the striking regenerative potential of PEPs in vivo. It is significant that PEPs engrafted into the alveolar walls of the lungs of BLM-challenged animals only. These findings support the view that tissue injury is necessary to create a specific microenvironment that promotes engraftment and subsequent differentiation of PEPs. Our data are consistent with other studies that have demonstrated the occurrence of tissue-specific differentiation of engrafted bone marrow cells only in challenged animals (17, 19).
Accumulating evidence supports a beneficial role of administered stem or precursor cells in several injury models (5, 28, 42–45). Here we have demonstrated that intratracheal injection of PEPs in the BLM-injury model resulted in complete protection from pulmonary fibrosis. Other studies have shown that injection of bone marrow–derived stem cells can ameliorate BLM-induced lung fibrosis (18, 19). In line with these studies, we found that beneficial effects occur only when PEPs are injected during the early phases after BLM instillation. Intrapulmonary delivery of mesenchymal stem cells has been shown to attenuate the effects of pulmonary injury in different animal models when administered at early stages (46, 47), indicating that stem cells of hematopoietic and mesenchymal origin share similar immunological properties. It remains to be established whether bone marrow–derived stem cells might exert a similar protective potential in reverting BLM-induced effects at the late stages of fibrosis. In the presence of profibrotic cytokines and massive damage to the whole alveolar epithelium, a higher number of cells might be required to exert an adequate response.
Our study also demonstrates that PEPs exerted an antiinflammatory effect in vivo and suppressed AM proliferation in vitro. Baran and colleagues (31) have shown that the presence of macrophages is crucial for development of BLM-induced fibrosis. The fundamental role of AM in the context of lung injury has been similarly noted in other studies (48, 49). We found that injection of PEPs suppressed the production of cytokines secreted by macrophages, such as KC/CXCL1, which might explain the lack of neutrophils recruitment to the lungs of PEPs-treated BLM-challenged mice. In addition, no upregulation of SDF-1α was found in lungs of the PEPs-treated mice. Lack of SDF-1α upregulation, as well as CCL21, might impair recruitment of circulating fibrocytes (33) and bone marrow–derived fibroblasts to injured lung (32).
The suppressive effect of PEPs-treatment on AM proliferation was mediated by NO production. In vitro, AM growth suppression was restored in presence of NO inhibitor l-NAME. In accordance with this finding, PEPs expanded from iNOS−/− mice could not suppress AM proliferation in vitro and failed to protect from BLM-induced injury in vivo. Interestingly, our data show that whereas normally cultured PEPs could not secrete NO, they did so when stimulated with LPS and IFN-γ. This would suggest that a specific environment (e.g., inflammatory) is necessary for PEPs to exert their NO-based immunomodulatory effect. Of note, the administration of NO-producing cells, such as bone marrow–derived macrophages and bone marrow–derived dendritic cells, did not exert any protective effect, therefore emphasizing the specific role of prominin-1+ cells. We can only speculate whether NO-producing cells other than the prominin-1+ cells secrete proinflammatory factors that in turn compensate the potential beneficial effects of NO release. Likewise, a recent study has shown that bone marrow–derived prominin-1/CD133+ cardiac progenitors protect from autoimmune myocarditis in mice through an NO-mediated mechanism (28). Moreover, our data are consistent with the reported benefits of NO inhalation in other lung injury models (40), confirming that low concentrations of NO exert a protective effect, despite the evidence that iNOS−/− mice are protected from BLM-induced fibrosis (50). Collectively, these findings strongly support that NO-dependent mechanisms play a critical role in PEPs protection from BLM-induced pulmonary fibrosis. Although BLM may damage structural cells of the lungs directly, its principal mode of action in leading to IPF-like pathology seems to be via endogenous mediators of inflammation, fibrinolysis, and proliferation. Thus, the development of pulmonary fibrosis represents a well-orchestrated process involving different cells at many active sites/interfaces. Aside from AM, other cells, such as T cells, neutrophils, and natural killer cells, for example, may also contribute to the pathogenesis of IPF. Therefore, nitric oxide may not only affect AM but may also influence the pathogenic process in other ways.
PEPs represent a population of prominin-1+ bone marrow–derived cells. Prominin-1+cells are also found in blood and bone marrow of healthy animals, but do not share analogous regenerative and immunomodulatory properties with PEPs (unpublished data). We believe that either the specific microenvironment created by disintegration of whole pulmonary tissue or inflammatory processes are critical for the activation and expansion of immunomodulatory and regenerative PEPs. Appropriate adaptation and optimization of culture conditions for blood- or bone marrow–derived cells might enable isolation and expansion of vast numbers of immunomodulatory/regenerative cells from the peripheral circulation as well. This would be a further step toward an innovative treatment strategy against inflammatory pulmonary diseases.
In conclusion, we have been successful in the expansion of a bone marrow–derived epithelial progenitor population from adult murine lungs with immunosuppressive and regenerative capacities. Our study represents an important step toward the development of novel cell-based therapies not only for IPF but also for other pulmonary disorders, such as acute respiratory distress syndrome, asthma, chronic obstructive pulmonary disease, or sepsis.
The authors thank Dr. Adrian J. Hobbs for providing C57Bl/6 iNOS−/− mice, Prof. Alex N. Eberle for providing 3T3-L1 cells, Heidi Bodmer and Marta Bachmann for technical assistance, Prof. Therese J. Resink for critical reading, and Verena Jäggin and Emmanuel Traunecker for cell-sorting.
| 1. | Verma S, Slutsky AS. Idiopathic pulmonary fibrosis—new insights. N Engl J Med 2007;356:1370–1372. |
| 2. | Perez A, Rogers RM, Dauber JH. The prognosis of idiopathic pulmonary fibrosis. Am J Respir Cell Mol Biol 2003;29:S19–S26. |
| 3. | Bowden DH. Unraveling pulmonary fibrosis: the bleomycin model. Lab Invest 1984;50:487–488. |
| 4. | Hay J, Shahzeidi S, Laurent G. Mechanisms of bleomycin-induced lung damage. Arch Toxicol 1991;65:81–94. |
| 5. | Mimeault M, Batra SK. Recent progress on tissue-resident adult stem cell biology and their therapeutic implications. Stem Cell Rev 2008;4:27–49. |
| 6. | Otto WR. Lung epithelial stem cells. J Pathol 2002;197:527–535. |
| 7. | Borthwick DW, Shahbazian M, Krantz QT, Dorin JR, Randell SH. Evidence for stem-cell niches in the tracheal epithelium. Am J Respir Cell Mol Biol 2001;24:662–670. |
| 8. | Giangreco A, Reynolds SD, Stripp BR. Terminal bronchioles harbor a unique airway stem cell population that localizes to the bronchoalveolar duct junction. Am J Pathol 2002;161:173–182. |
| 9. | Kim CF, Jackson EL, Woolfenden AE, Lawrence S, Babar I, Vogel S, Crowley D, Bronson RT, Jacks T. Identification of bronchioalveolar stem cells in normal lung and lung cancer. Cell 2005;121:823–835. |
| 10. | Park KS, Wells JM, Zorn AM, Wert SE, Laubach VE, Fernandez LG, Whitsett JA. Transdifferentiation of ciliated cells during repair of the respiratory epithelium. Am J Respir Cell Mol Biol 2006;34:151–157. |
| 11. | Mason RJ, Williams MC. Type II alveolar cell. Defender of the alveolus. Am Rev Respir Dis 1977;115:81–91. |
| 12. | Bishop AE. Pulmonary epithelial stem cells. Cell Prolif 2004;37:89–96. |
| 13. | Jiang Y, Jahagirdar BN, Reinhardt RL, Schwartz RE, Keene CD, Ortiz-Gonzalez XR, Reyes M, Lenvik T, Lund T, Blackstad M, et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 2002;418:41–49. |
| 14. | Okamoto R, Yajima T, Yamazaki M, Kanai T, Mukai M, Okamoto S, Ikeda Y, Hibi T, Inazawa J, Watanabe M. Damaged epithelia regenerated by bone marrow-derived cells in the human gastrointestinal tract. Nat Med 2002;8:1011–1017. |
| 15. | Herzog EL, Van Arnam J, Hu B, Krause DS. Threshold of lung injury required for the appearance of marrow-derived lung epithelia. Stem Cells 2006;24:1986–1992. |
| 16. | Theise ND, Henegariu O, Grove J, Jagirdar J, Kao PN, Crawford JM, Badve S, Saxena R, Krause DS. Radiation pneumonitis in mice: a severe injury model for pneumocyte engraftment from bone marrow. Exp Hematol 2002;30:1333–1338. |
| 17. | Macpherson H, Keir P, Webb S, Samuel K, Boyle S, Bickmore W, Forrester L, Dorin J. Bone marrow-derived SP cells can contribute to the respiratory tract of mice in vivo. J Cell Sci 2005;118:2441–2450. |
| 18. | Rojas M, Xu J, Woods CR, Mora AL, Spears W, Roman J, Brigham KL. Bone marrow-derived mesenchymal stem cells in repair of the injured lung. Am J Respir Cell Mol Biol 2005;33:145–152. |
| 19. | Ortiz LA, Gambelli F, McBride C, Gaupp D, Baddoo M, Kaminski N, Phinney DG. Mesenchymal stem cell engraftment in lung is enhanced in response to bleomycin exposure and ameliorates its fibrotic effects. Proc Natl Acad Sci USA 2003;100:8407–8411. |
| 20. | Yamada M, Kubo H, Kobayashi S, Ishizawa K, Numasaki M, Ueda S, Suzuki T, Sasaki H. Bone marrow-derived progenitor cells are important for lung repair after lipopolysaccharide-induced lung injury. J Immunol 2004;172:1266–1272. |
| 21. | Kania G, Corbeil D, Fuchs J, Tarasov KV, Blyszczuk P, Huttner WB, Boheler KR, Wobus AM. Somatic stem cell marker prominin-1/CD133 is expressed in embryonic stem cell-derived progenitors. Stem Cells 2005;23:791–804. |
| 22. | Bauer N, Fonseca AV, Florek M, Freund D, Jaszai J, Bornhauser M, Fargeas CA, Corbeil D. New insights into the cell biology of hematopoietic progenitors by studying prominin-1 (CD133). Cells Tissues Organs 2008;188:127–138. |
| 23. | Corbeil D, Roper K, Hellwig A, Tavian M, Miraglia S, Watt SM, Simmons PJ, Peault B, Buck DW, Huttner WB. The human AC133 hematopoietic stem cell antigen is also expressed in epithelial cells and targeted to plasma membrane protrusions. J Biol Chem 2000;275:5512–5520. |
| 24. | Shmelkov SV, Butler JM, Hooper AT, Hormigo A, Kushner J, Milde T, St Clair R, Baljevic M, White I, Jin DK, et al. CD133 expression is not restricted to stem cells, and both CD133+ and CD133- metastatic colon cancer cells initiate tumors. J Clin Invest 2008;118:2111–2120. |
| 25. | Barfield RC, Hale GA, Burnette K, Behm FG, Knapp K, Eldridge P, Handgretinger R. Autologous transplantation of CD133 selected hematopoietic progenitor cells for treatment of relapsed acute lymphoblastic leukemia. Pediatr Blood Cancer 2007;48:349–353. |
| 26. | Bartunek J, Vanderheyden M, Vandekerckhove B, Mansour S, De Bruyne B, De Bondt P, Van Haute I, Lootens N, Heyndrickx G, Wijns W. Intracoronary injection of CD133-positive enriched bone marrow progenitor cells promotes cardiac recovery after recent myocardial infarction: feasibility and safety. Circulation 2005;112:I178–I183. |
| 27. | Furst G, Schulte am Esch J, Poll LW, Hosch SB, Fritz LB, Klein M, Godehardt E, Krieg A, Wecker B, Stoldt V, et al. Portal vein embolization and autologous CDd133+ bone marrow stem cells for liver regeneration: Initial experience. Radiology 2007;243:171–179. |
| 28. | Kania G, Blyszczuk P, Valaperti A, Dieterle T, Leimenstoll B, Dirnhofer S, Zulewski H, Eriksson U. Prominin-1+/CD133+ bone marrow-derived heart-resident cells suppress experimental autoimmune myocarditis. Cardiovasc Res 2008;80:236–245. |
| 29. | Rippon HJ, Ali NN, Polak JM, Bishop AE. Initial observations on the effect of medium composition on the differentiation of murine embryonic stem cells to alveolar type II cells. Cloning Stem Cells 2004;6:49–56. |
| 30. | Lee CG, Homer RJ, Zhu Z, Lanone S, Wang X, Koteliansky V, Shipley JM, Gotwals P, Noble P, Chen Q, et al. Interleukin-13 induces tissue fibrosis by selectively stimulating and activating transforming growth factor beta(1). J Exp Med 2001;194:809–821. |
| 31. | Baran CP, Opalek JM, McMaken S, Newland CA, O'Brien JM Jr, Hunter MG, Bringardner BD, Monick MM, Brigstock DR, Stromberg PC, et al. Important roles for macrophage colony-stimulating factor, CC chemokine ligand 2, and mononuclear phagocytes in the pathogenesis of pulmonary fibrosis. Am J Respir Crit Care Med 2007;176:78–89. |
| 32. | Hashimoto N, Jin H, Liu T, Chensue SW, Phan SH. Bone marrow-derived progenitor cells in pulmonary fibrosis. J Clin Invest 2004;113:243–252. |
| 33. | Phillips RJ, Burdick MD, Hong K, Lutz MA, Murray LA, Xue YY, Belperio JA, Keane MP, Strieter RM. Circulating fibrocytes traffic to the lungs in response to CXCL12 and mediate fibrosis. J Clin Invest 2004;114:438–446. |
| 34. | De Caterina R, Libby P, Peng HB, Thannickal VJ, Rajavashisth TB, Gimbrone MA Jr, Shin WS, Liao JK. Nitric oxide decreases cytokine-induced endothelial activation. Nitric oxide selectively reduces endothelial expression of adhesion molecules and proinflammatory cytokines. J Clin Invest 1995;96:60–68. |
| 35. | Kim YM, Talanian RV, Billiar TR. Nitric oxide inhibits apoptosis by preventing increases in caspase-3-like activity via two distinct mechanisms. J Biol Chem 1997;272:31138–31148. |
| 36. | Sato K, Ozaki K, Oh I, Meguro A, Hatanaka K, Nagai T, Muroi K, Ozawa K. Nitric oxide plays a critical role in suppression of T-cell proliferation by mesenchymal stem cells. Blood 2007;109:228–234. |
| 37. | Valaperti A, Marty RR, Kania G, Germano D, Mauermann N, Dirnhofer S, Leimenstoll B, Blyszczuk P, Dong C, Mueller C, et al. CD11b+ monocytes abrogate Th17 CD4+ T cell-mediated experimental autoimmune myocarditis. J Immunol 2008;180:2686–2695. |
| 38. | McElroy MC, Wiener-Kronish JP, Miyazaki H, Sawa T, Modelska K, Dobbs LG, Pittet JF. Nitric oxide attenuates lung endothelial injury caused by sublethal hyperoxia in rats. Am J Physiol 1997;272:L631–L638. |
| 39. | Kobayashi H, Hataishi R, Mitsufuji H, Tanaka M, Jacobson M, Tomita T, Zapol WM, Jones RC. Antiinflammatory properties of inducible nitric oxide synthase in acute hyperoxic lung injury. Am J Respir Cell Mol Biol 2001;24:390–397. |
| 40. | Gazoni LM, Tribble CG, Zhao MQ, Unger EB, Farrar RA, Ellman PI, Fernandez LG, Laubach VE, Kron IL. Pulmonary macrophage inhibition and inhaled nitric oxide attenuate lung ischemia-reperfusion injury. Ann Thorac Surg 2007;84:247–253. |
| 41. | Summer R, Fitzsimmons K, Dwyer D, Murphy J, Fine A. Isolation of an adult mouse lung mesenchymal progenitor cell population. Am J Respir Cell Mol Biol 2007;37:152–159. |
| 42. | Pluchino S, Zanotti L, Rossi B, Brambilla E, Ottoboni L, Salani G, Martinello M, Cattalini A, Bergami A, Furlan R, et al. Neurosphere-derived multipotent precursors promote neuroprotection by an immunomodulatory mechanism. Nature 2005;436:266–271. |
| 43. | Khalil PN, Weiler V, Nelson PJ, Khalil MN, Moosmann S, Mutschler WE, Siebeck M, Huss R. Nonmyeloablative stem cell therapy enhances microcirculation and tissue regeneration in murine inflammatory bowel disease. Gastroenterology 2007;132:944–954. |
| 44. | Lee ST, Chu K, Jung KH, Kim SJ, Kim DH, Kang KM, Hong NH, Kim JH, Ban JJ, Park HK, et al. Anti-inflammatory mechanism of intravascular neural stem cell transplantation in haemorrhagic stroke. Brain 2008;131:616–629. |
| 45. | Cerletti M, Jurga S, Witczak CA, Hirshman MF, Shadrach JL, Goodyear LJ, Wagers AJ. Highly efficient, functional engraftment of skeletal muscle stem cells in dystrophic muscles. Cell 2008;134:37–47. |
| 46. | Baber SR, Deng W, Master RG, Bunnell BA, Taylor BK, Murthy SN, Hyman AL, Kadowitz PJ. Intratracheal mesenchymal stem cell administration attenuates monocrotaline-induced pulmonary hypertension and endothelial dysfunction. Am J Physiol Heart Circ Physiol 2007;292:H1120–H1128. |
| 47. | Gupta N, Su X, Popov B, Lee JW, Serikov V, Matthay MA. Intrapulmonary delivery of bone marrow-derived mesenchymal stem cells improves survival and attenuates endotoxin-induced acute lung injury in mice. J Immunol 2007;179:1855–1863. |
| 48. | Naidu BV, Krishnadasan B, Farivar AS, Woolley SM, Thomas R, Van Rooijen N, Verrier ED, Mulligan MS. Early activation of the alveolar macrophage is critical to the development of lung ischemia-reperfusion injury. J Thorac Cardiovasc Surg 2003;126:200–207. |
| 49. | Zhao M, Fernandez LG, Doctor A, Sharma AK, Zarbock A, Tribble CG, Kron IL, Laubach VE. Alveolar macrophage activation is a key initiation signal for acute lung ischemia-reperfusion injury. Am J Physiol Lung Cell Mol Physiol 2006;291:L1018–L1026. |
| 50. | Genovese T, Cuzzocrea S, Di Paola R, Failla M, Mazzon E, Sortino MA, Frasca G, Gili E, Crimi N, Caputi AP, et al. Inhibition or knock out of inducible nitric oxide synthase result in resistance to bleomycin-induced lung injury. Respir Res 2005;6:58. |
