Abstract
Susceptibility to atopic diseases is known to involve genetic factors. The interleukin-4 (IL-4) receptor- α gene (IL4R) reportedly is involved in the development of atopy. A recent study has shown the Ile50 allele of a polymorphism (Ile50Val) of IL4R to be associated with atopy. The objective of this study was to replicate this association and confirm the possible role of the Ile50Val polymorphism of IL4R in the etiology of atopic asthma in a Japanese population. We conducted a transmission disequilibrium test in 86 families identified through asthmatic children. A case-control study was also carried out using both atopic and control subjects. The IL4R Ile50Val polymorphism was genotyped by a PCR-restriction fragment length polymorphism method using an intronic upstream primer. The IL4R Ile50 allele was not preferentially transmitted to atopy- or to asthma-affected children. Neither the Ile50 allele nor the Ile50/Ile50 genotype was more prevalent in the atopic subjects than in the control subjects. Our findings indicate that the Ile50Val polymorphism of IL4R does not play a substantial role in genetic predisposition for the etiology of atopy or asthma in this Japanese population.
Atopy, expressed clinically as asthma, atopic dermatitis, and/or rhinoconjunctivitis, is characterized by a genetic predisposition for generating IgE antibody against common environmental allergens. Since family and twin studies demonstrated an involvement of genetic components in the development of atopy and asthma (1, 2), much work has been done to find the responsible gene(s). Several loci linked to atopy and asthma have been suggested through genome-wide linkage studies (3, 4).
Interleukin 4 (IL-4) is likely to play a major role in allergic disease since it mediates Ig isotype switching from IgM to IgE (5). IL-4 operates through the IL-4 receptor (IL4R). Mice deficient in the IL4Rα chain lack IgE production (6). The IL4R is composed of two subunits: an α subunit that binds IL-4 and transduces its growth-promoting and transcription-activating functions (7, 8) and a γ subunit that is common to several cytokine receptors and amplifies signaling of the α subunit (9, 10). Because the IL-4 receptor α plays a central role in regulating the production of IgE, the gene on chromosome 16p12 encoding IL-4 receptor α protein is considered a candidate for atopy-related diseases. Recently, Mitsuyasu and colleagues (11) reported that the Ile50 allele of IL4R, the only known extracellular variant of human IL4Rα, is strongly associated with the development of atopic asthma in the Japanese population. The association with atopic asthma was especially strong in children. The high frequency (approximately 60% compared with 17% in control subjects) of Ile50 homozygotes in the childhood atopic asthma group and the significant skewing from Hardy-Weinberg equilibrium suggested a largely recessive genetic effect of Ile50 on atopy. The odds ratio of the Ile50 allele association with atopic asthma reached as high as 6.30 (95% confidence interval [CI], 3.66 to 10.45). Analysis of mouse and human cell line transfectants suggested that the Ile50 variant upregulates receptor response to IL-4, with a resulting increased activation of Stat6 and that it increases cell proliferation and IgE production (11). No difference between Ile50- and Val 50-transfected cells was detected in binding assays.
The report by Mitsuyasu and colleagues (11) is important because if the reported association is true, the Ile50 would be a major gene associated with atopic asthma, at least in the Japanese. To confirm the role of the Ile50Val polymorphism in the development of atopy and asthma, we performed an association study using two methods: a transmission disequilibrium test (TDT) involving 86 asthmatic Japanese families and a case-control comparison.
Probands of the families studied were asthmatic children attending the Pediatric Allergy Clinic of the University Hospital of Tsukuba. A full verbal and written explanation of the study was given to all family members interviewed, and 86 families (375 members including 172 atopic asthma children) gave informed consent and participated in this study. Informed consent for subjects younger than school age was given by their parents. The mean age of the probands and their siblings was 11.2 yr (range, 3 to 29 yr); the mean age of the parents was 41.1 yr (28 to 72 yr). The families members examined in this study were in part the same ones who participated in our previous study (12).
Each family member was questioned regarding allergic symptoms and underwent a physical examination by pediatricians. Asthma was diagnosed in subjects according to the criteria of the National Institutes of Health, USA, with minor modifications (13). Patients had to show the two following characteristics: (1) two or more episodes of wheezing and shortness of breath during the previous year and (2) reversibility of the wheezing and dyspnea, either spontaneously or by bronchodilator treatment. Patients treated with systemic steroids were excluded from this study. Because wheezing is often associated with viral respiratory infection in young children (14), subjects older than 3 yr of age were evaluated for the asthma phenotype. Young adult patients included in this study had had chronic asthma since childhood. The diagnosis of asthma in this population was confirmed by physicians or pediatricians. All of our patients fit the criteria of Mitsuyasu and colleagues (11).
For the case-control study, in addition to the 86 probands of the above-mentioned families, 15 unrelated children with atopic asthma were added to the atopic asthma group. The control group was composed of unrelated subjects living near the University Hospital. We selected control subjects who met all of the following criteria: (1) no symptoms and history of allergic diseases, (2) no detectable dust-mite-specific IgE antibody, and (3) total serum IgE levels below the general population mean for their ages. This study was approved by the Committee of Ethics, the University of Tsukuba.
Total serum IgE levels and specific IgE levels to house dust mite, Dermatophagoides farinae (Df ), were determined by the Pharmacia CAP System (Pharmacia, Uppsala, Sweden). Atopy was defined by the presence of either or both of the following: a total serum IgE level more than 1 standard deviation above the geometric mean for the normal Japanese population and/or raised specific serum IgE levels to Df (> 0.35 UA/ml). IgE levels were defined as high in subjects whose total serum IgE exceeded 400 IU/ml, and mite antibody was considered positive in those having detectable Df-specific IgE (> 0.35 UA/ ml), following the criteria of Mitsuyasu and colleagues (11).
DNA was extracted from peripheral blood leukocytes. Because we could not obtain unambiguous PCR products using the primers described by Mitsuyasu and colleagues (11), who used only the exonic sequence to compose the primer, we determined the intronic sequence upstream to the exon, including the Ile50Val polymorphism using the primer pairs 5′-GCGAGTGGAAGATGAATGGT (nucleotide number [nn] 306-325 of GenBank accession no. X52425) and 5′-CGCTGGGCTTGAAGGAG (nn 514-530). Thirty-five cycles of PCR were performed at 94° C for 60 s, at 65° C for 60 s, and at 72° C for 3 min using Takara la Taq polymerase (Takara, Tokyo, Japan). An approximately 3,000-kb product was obtained and sequenced using a thermal cycle sequencing kit (U.S. Biochemical Corp., Cleveland, OH) on an Applied Biosystems auto sequencer (Perkin-Elmer, Foster City, CA).
The Ile50Val polymorphism was genotyped by PCR restriction fragment length polymorphism (RFLP) analysis using the primer pair 5′-GGCAGGTGTGAGGAGCATCC, 252-233 bp upstream of the Ile50Val polymorphic site and 5′-GCCTCCGTTGTTCTCAGGTA (nn 399-418). The original sequence of positions 399 to 418 in the IL-4 receptor gene sequence for the downstream primer is TCCCTGAGAACAACGGAGGC (GCCTCCGTTGTTCTCAGGGA for reverse sequence). The mismatch was introduced in the downstream primer to obtain the RsaI restriction site because we experienced partial digestion with MslI, which naturally recognizes the polymorphism, when we did preliminary experiments. PCR was performed with a 96-well plate using a programmable thermal cycler (PTC-100; MJ Research, Inc., Watertown, MA) at 93° C for 5 min, followed by 36 cycles at 93° C for 60 s, at 60° C for 60 s, and 72° C for 60 s. PCR fragments digested with RsaI were electrophoresed in 1.5% agarose + 3.0% NuSieve agarose gel (FMC BioProducts, Rockland, ME) and visualized by ethidium bromide staining and ultraviolet transillumination. The accuracy of this genotyping method was confirmed by direct sequencing of samples from two subjects with each genotype (Ile50/Ile50, Ile50/Val50, Val50/Val50).
Examples are shown in Figure 1 of the Ile50Val polymorphism, a homozygote for the wild type allele (lane 1, Ile/Ile), a homozygote for the Val50 allele (lane 2, Val/Val), and a heterozygote for the wild type allele and the Val50 allele (lane 3, Ile/Val).
Fig. 1. Genotyping of the Ile50Val polymorphism of IL4R by PCR-RFLP method in three unrelated subjects. Subject 1 = homozygote for the Ile50 allele; Subject 2 = heterozygote for the Ile50 and Val50 allele; Subject 3 = homozygote for the Val50 allele. M = pGEM marker (Promega, Madison, WI).
[More] [Minimize]TDT of the Ile50Val polymorphism was performed using the ASTDT routine in the Genome Analysis System software (GAS ver 2.0; A. Young, University of Oxford, 1993–1995). Case control comparisons of allele and genotype numbers were carried out using the chi-square test.
The results of the TDT between the Ile50 and Val50 alleles in atopy and asthma in the families are shown in Table 1. The number of Ile/Ile, Ile/Val, and Val/Val genotypes in the parents were 30 (17%), 72 (42%), and 70 (41%), respectively, which did not deviate from expected values based on Hardy-Weinberg equilibrium. We assumed the Ile50 allele to be an atopy- and asthma-associated allele. Under a hypothesis of no linkage, the expected number of transmissions of Ile50 and Val50 alleles is equal. The TDT showed that the Ile50 allele was not preferentially transmitted to atopy- or asthma-affected children (p = 0.87 and 0.92, respectively).
| Number of Alleles Transmitted | p Value (binomial ) | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Ile50 | Val50 | Total | ||||||||
| Atopy | Observed | 61 | 75 | 136 | 0.87 | |||||
| Expected | 68 | 68 | ||||||||
| Asthma | Observed | 51 | 67 | 118 | 0.92 | |||||
| Expected | 59 | 59 | ||||||||
The results of the association study are shown in Table 2. Again, neither the Ile50 allele nor the Ile50/Ile50 genotype was more prevalent in the atopic subjects than in the control subjects.
| Subjects (n) | Genotype | p Value* | Odds Ratio (95% CI)* | Allele | p Value | Odds Ratio (95% CI) | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Ile/Ile | Ile/Val | Val/Val | Ile50 | Val50 | ||||||||||||||||
| Subjects with | 101 | 10 (0.10) | 57 (0.56) | 34 (0.34) | 77 (0.38) | 125 (0.62) | ||||||||||||||
| atopic asthma† | ||||||||||||||||||||
| Control subjects | 101 | 16 (0.16) | 44 (0.44) | 41 (0.41) | 0.21 | 0.58 | 76 (0.38) | 126 (0.62) | 0.92 | 1.02 | ||||||||||
| (0.26–1.34) | (0.68–1.52) | |||||||||||||||||||
| Low total IgE‡ | 170 | 26 (0.15) | 79 (0.47) | 65 (0.38) | 131 (0.39) | 209 (0.61) | ||||||||||||||
| High total IgE‡ | 86 | 12 (0.14) | 42 (0.49) | 32 (0.37) | 0.92 | 0.91 | 66 (0.38) | 106 (0.62) | 0.95 | 0.99 | ||||||||||
| (0.45–1.88) | (0.68–1.45) | |||||||||||||||||||
| Mite antibody(+)§ | 105 | 15 (0.14) | 51 (0.49) | 39 (0.37) | 81 (0.39) | 129 (0.61) | ||||||||||||||
| Mite antibody(−)§ | 111 | 20 (0.18) | 46 (0.41) | 45 (0.41) | 0.56 | 0.76 | 86 (0.39) | 136 (0.61) | 0.95 | 1.01 | ||||||||||
| (0.38–1.56) | (0.68–1.49) | |||||||||||||||||||
The present study failed to replicate the association reported by Mitsuyasu and colleagues (11) between the Ile50 allele of IL4R and the atopic phenotypes. In our current study, the atopic asthmatics were children (as were the subjects in their study), and the odds ratio was 0.58 (95% CI, 0.26 to 1.34), which is significantly different from their results (see opening statement). It is difficult to explain the discrepancy between these two studies because the subjects studied by both Mitsuyasu and colleagues and us were Japanese, and in fact the allele frequency in the control subjects of Mitsuyasu and colleagues (0.40) were similar to ours (0.38) (χ2 = 0.36, p = 0.55). Although the sample size of our case-control study was slightly smaller than that of Mitsuyasu and colleagues (11), the power to detect the association in this study was more than 0.999, assuming that the odds ratio = 6.30, the disorder prevalence = 0.04, the Ile50/Ile50 genotype frequency = 0.16, and the alpha level is set to 0.05 one-sided (15). Even if the lowest end of 95% CI of the odds ratio reported by Mitsuyasu and colleagues (3.66) is assumed, the power of our study to detect the association is still quite high (0.97). In addition to a case-control study, in which it is always difficult to assert that control subjects really do match patients, we performed TDT, in which nontransmitted alleles are treated as controls. Again, no preferential transmission of the Ile50 allele to atopic asthmatics was observed.
The area in which we collected the sample (Kanto area) is about 500 km from that in which the Mitsuyasu group collected (Kansai area). Although the Japanese population is considered to be relatively homogenous, it is hard to know how genetically similar these two populations are. However, distribution of the genotypes of other genes such as apolipoprotein E, angiotensin-converting enzyme, mast-cell chymase, and Ile50Val polymorphism in control subjects from the Kanto area and those from the Kansai area was similar (11, 16-20). Therefore, it is unlikely that there is genetic heterogeneity between the Mitsuyasu population and ours.
If the association reported by Mitsuyasu and colleagues (11) is true, linkage studies using simple affected sib-pair methods are expected to detect linkage even by analyzing a relative small sample size; as small as 35 sib-pairs are expected to detect linkage at p < 0.001 on average. We conducted linkage analysis using microsatellite markers flanking the IL4Rα gene in 82 families ascertained through asthmatic children (21), and showed no evidence for linkage of the asthma or atopy phenotypes with the markers flanking the IL4Rα gene. Deichmann and colleagues employed linkage analysis using four polymorphic markers flanking IL4R in atopic families and did not find significant evidence for linkage between phenotypes of elevated total IgE levels and markers on chromosome 16p12 (22). However, since the Ile50 allele is regarded as a wild-type allele, it remains possible that the Ile50/Ile50 genotype frequency is too high to detect linkage in the studied populations other than Japanese.
Another polymorphism of IL4R, R576Q has recently been identified and shown to be associated with hyper-IgE syndrome, severe atopic dermatitis, and a phenotype of atopy (23) Functional assays has shown that the mutant allele (R576) is associated with enhanced signaling when compared with the wild-type allele (Q576). The IL-4 receptor Q576R polymorphism was also genotyped in our population, but we did not find an association between Q576R polymorphism and atopy or asthma by TDT and the case-control study (21). Because our atopic subjects did not include hyper-IgE syndrome or severe atopic dermatitis, the possibility remains that this polymorphism may contribute to the development of hyper-IgE syndrome and severe atopic dermatitis.
IL-4 is known to enhance the production of immunoglobulins (particularly IgG1 and IgE) from activated B cells (5, 24). It also activates the IL-4 receptor, which triggers IgE production of B-cells and induces endothelium to express adhesion molecules that specifically attract eosinophils (24, 25). Therefore, genetic regulation of the IL-4 cascade is still considered to play an important regulatory role in the predisposition for development of allergic diseases.
Our results indicate that the IL4R does not exert a substantial influence on the inheritance of atopy or asthma in the Japanese population. However, since the sample size of the present study was relatively small, we cannot exclude the possibility that either or both Ile50 and R576 have a small effect on the development of atopy/asthma. Linkage and association studies in different populations are needed to elucidate the role of IL4R in the development of atopy and asthma.
Supported in part by Grant 10168201 from the Ministry of Welfare of Japan.
| 1. | Sibbald B., Horn M. E., Gregg I.A family study of the genetic basis of asthma and wheezy bronchitis. Arch. Dis. Child.551980354357 |
| 2. | Duffy D. L., Martin N. G., Battistutta D., Hopper J. L., Mathews J. D.Genetics of asthma and hay fever in Australian twins. Am. Rev. Respir. Dis.142199013511358 |
| 3. | The Collaborative Study of Genetics of AsthmaA genome-wide search for asthma susceptibility loci in ethnically diverse populations. Nat. Genet.151997389392 |
| 4. | Daniels S. E., Bhattacharrya S., James A., Leaves N. I., Young A., Hill M. R., Faux J. A., Ryan G. F., Le Souef P., Lathrop G. M., Musk A. W., Cookson W. O.A genome-wide search for quantitative trait loci underlying asthma. Nature3831996247250 |
| 5. | Gauchat, J. F., D. A. Lebman, R. L. Coffman, H. Gascan, and V. J. de. 1990. Structure and expression of germline epsilon transcripts in human B cells induced by interleukin 4 to switch to IgE production. J. Exp. Med. 172:463–473. |
| 6. | Noben-Trauth N., Shultz L. D., Brombacher F., Urban J. F., Gu H., Paul W. E.An interleukin 4 (IL-4)-independent pathway for CD4+ T cell IL-4 production is revealed in IL-4 receptor-deficient mice. Proc. Natl. Acad. Sci. U.S.A.9419971083810843 |
| 7. | Galizzi J. P., Zuber C. E., Harada N., Gorman D. M., Djossou O., Kastelein R., Banchereau J., Howard M., Miyajima A.Molecular cloning of a cDNA encoding the human interleukin 4 receptor. Int. Immunol.21990669675 |
| 8. | Idzerda R. L., March C. J., Mosley B., Lyman S. D., Vanden T., Bos, Gimpel S. D., Din W. S., Grabstein K. H., Widmer M. B., Park L. S., Cosman D., Beckmann M. P.Human interleukin 4 receptor confers biological responsiveness and defines a novel receptor superfamily. J. Exp. Med.1711990861873 |
| 9. | Kondo M., Takeshita T., Ishii N., Nakamura M., Watanabe S., Arai K., Sugamura K.Sharing of the interleukin-2 (IL-2) receptor gamma chain between receptors for IL-2 and IL-4. Science262199318741877 |
| 10. | Russell S. M., Keegan A. D., Harada N., Nakamura Y., Noguchi M., Leland P., Friedmann M. C., Miyajima A., Puri R. K., Paul W. E., Leonard W. J.Interleukin-2 receptor gamma chain: a functional component of the interleukin-4 receptor. Science262199318801883 |
| 11. | Mitsuyasu H., Izuhara K., Mao X. Q., Gao P. S., Arinobu Y., Enomoto T., Kawai M., Sasaki S., Dake Y., Hamasaki N., Shirakawa T., Hopkin J. M.Ile50Val variant of IL4R alpha upregulates IgE synthesis and associates with atopic asthma. Nat Genet191998119120 |
| 12. | Noguchi E., Shibasaki M., Arinami T., Takeda K., Maki T., Miyamoto T., Kawashima T., Kobayashi K., Hamaguchi H.Evidence for linkage between asthma/atopy in childhood and chromosome 5q31-q33 in a Japanese population. Am. J. Respir. Crit. Care Med.156199713901393 |
| 13. | National Heart, Lung, and Blood Institute, National Institutes of Health, 1995. Guidelines for the diagnosis and management of asthma. U.S. Government Printing Office, Washington, DC. Publication No. 95-36S9. |
| 14. | Martinez F. D., Wright A. L., Taussig L. M., Holberg C. J., Halonen M., Morgan W. J.Asthma and wheezing in the first six years of life. The Group Health Medical Associates. N. Engl. J. Med.3321995133138 |
| 15. | Cohen, J. 1980. Statistical Power Analysis for the Behavioral Sciences. Lawrence Erlbaum Associates, Hillsdale, NJ. |
| 16. | Kogawa K., Nishizawa Y., Hosoi M., Kawagishi T., Maekawa K., Shoji T., Okuno Y., Morii H.Effect of polymorphism of apolipoprotein E and angiotensin-converting enzyme genes on arterial wall thickness. Diabetes461997682687 |
| 17. | Yanagi H., Shimakura Y., Yamanouchi Y., Watanabe Y., Tsuchiya S., Hamaguchi H.Association of hypercholesterolemia and apolipoprotein E4 in school children. Clin. Genet.381990264269 |
| 18. | Arinami T., Li L., Mitsushio H., Itokawa M., Hamaguchi H., Toru M.An insertion/deletion polymorphism in the angiotensin converting enzyme gene is associated with both brain substance P contents and affective disorders. Biol. Psychiatry40199611221127 |
| 19. | Kawashima T., Noguchi E., Arinami T., Kobayashi K., Otsuka F., Hamaguchi H.No evidence for an association between a variant of the mast cell chymase gene and atopic dermatitis based on case-control and haplotype-relative-risk analyses. Hum. Hered.481998271274 |
| 20. | Mao X. Q., Shirakawa T., Yoshikawa T., Yoshikawa K., Kawai M., Sasaki S., Enomoto T., Hashimoto T., Furuyama J., Hopkin J. M., Morimoto K.Association between genetic variants of mast-cell chymase and eczema. Lancet3481996581583 |
| 21. | Noguchi, E., M. Shibasaki, T. Arinami, K. Takeda, Y. Yokouchi, K. Kobayashi, N. Imoto, S. Nakahara, A. Matsui, and H. Hamaguchi. Lack of association of atopy/asthma and the interleukin 4 receptor alpha gene in Japanese. Clin. Exp. Allergy (In press) |
| 22. | Deichmann K. A., Heinzmann A., Forster J., Dischinger S., Mehl C., Brueggenolte E., Hildebrandt F., Moseler M., Kuehr J.Linkage and allelic association of atopy and markers flanking the IL4- receptor gene. Clin. Exp. Allergy281998151155 |
| 23. | Hershey G. K., Friedrich M. F., Esswein L. A., Thomas M. L., Chatila T. A.The association of atopy with a gain-of-function mutation in the alpha subunit of the interleukin-4 receptor. N. Engl. J. Med.337199717201725 |
| 24. | Coffman R. L., Carty J.A T cell activity that enhances polyclonal IgE production and its inhibition by interferon-gamma. J. Immunol.1361986949954 |
| 25. | Schnyder B., Lugli S., Feng N., Etter H., Lutz R. A., Ryffel B., Sugamura K., Wunderli-Allenspach H., Moser R.Interleukin-4 (IL-4) and IL-13 bind to a shared heterodimeric complex on endothelial cells mediating vascular cell adhesion molecule-1 induction in the absence of the common gamma chain. Blood87199642864295 |
