Abstract
Idiopathic pulmonary arterial hypertension (IPAH) is a fatal disease that comprises sustained vasoconstriction, enhanced proliferation of pulmonary vascular cells, and in situ thrombosis. The discovery of several contributing signaling pathways in recent years has resulted in an expanding array of novel therapies; however, IPAH remains a progressive disease with poor outcome in most instances. To identify new regulatory pathways of vascular remodeling in IPAH, we performed transcriptome-wide expression profiling of laser-microdissected pulmonary arterial resistance vessels derived from explanted IPAH and nontransplanted donor lung tissues. Statistical analysis of the data derived from six individuals in each group showed significant regulation of several mediators of the canonical and noncanonical WNT pathway. As to the noncanonical WNT pathway, the planar cell polarity (PCP) pathway, the ras homolog gene family member A (RHOA), and ras-related C3 botulinum toxin substrate-1 (RAC1) were strongly up-regulated. Real-time PCR of laser-microdissected pulmonary arteries confirmed these array results and showed in addition significant up-regulation of further PCP mediators wingless member 11 (WNT11), disheveled associated activator of morphogenesis-1 (DAAM1), disheveled (DSV), and RHO-kinase (ROCK). Immunohistochemical staining and semiquantitative expression analysis confirmed the markedly enhanced expression of the PCP mediators in the pulmonary resistance vessels, in particular in the endothelial layer in IPAH. Therefore we propose the PCP pathway to be critically involved in the regulation of vascular remodeling in IPAH.
Recently developed specific treatments for IPAH have significantly improved exercise capacity and survival, although the disease can often only be stabilized for a limited time. Therefore, more than half of the patients are in need of combination therapies as early as in their first 2 years of treatment. Currently, specific treatments include prostacyclin I2 analogs, endothelin receptor antagonists, and phosphodiesterase-5 inhibitors. These drugs target primarily pulmonary vasoconstriction and thereby only affect downstream manifestations of the disease, rather than influencing the central pathogenic mediators that lead to vascular remodeling and determine the progress of IPAH.
Therefore, therapeutic targeting of pathways involved in vascular cell proliferation is currently a strong research focus (platelet-derived growth factor [7], survivin [8], epidermal growth factor [9]). However, new and so far not anticipated regulators of vascular remodeling may only be found by chance or with an unbiased screening methodology. In the present study we employed whole genome expression profiling in an unbiased approach to allocate pathways involved in IPAH pathogenesis and vascular wall remodeling. As intrapulmonary small arteries represent only a minor portion of the lung tissue (< 10%), the specific expression profile of this compartment will be significantly masked or completely lost by the use of lung homogenate (10). To overcome this problem, a recently developed laser-assisted microdissection technique has been employed (11). As the amount of RNA from laser-microdissected material is limited and not sufficient for array hybridization, a pre-amplification technique was incorporated. Bioinformatical analysis of the gene expression sets indicated that the planar cell polarity pathway is changed significantly in IPAH compared with healthy donor lung tissue.
Lung tissues were collected from patients with IPAH undergoing lung transplantation at the Universities of Giessen (Germany) or Vienna (Austria). All patients were accessed, diagnosed, and treated in expert centers for PAH. Nontransplanted donor lung tissue showing no evidence of vascular pathology served as healthy control (Table 1). The protocol and tissue usage were approved by the institutional ethics committee, and informed consent was obtained before lung transplantation. Explanted lungs were directly rinsed until blood-free with ice-cold preservation buffer. Tissue samples were immediately frozen for later mRNA and protein analysis, and additional samples for immunohistochemistry were transferred to 4% phosphate-buffered paraformaldehyde and fixed for 24 hours at 4°C. The fixed samples were then dehydrated and paraffin embedded in a fully automated manner (Tissue processor ASP200; Leica, Heidelberg, Germany). Clinic pathological review of all lungs was performed, and the IPAH lungs were classified as grade III or IV according to the method of Heath and Edwards (12) (Table 1).
Laser-Microdissection of six donor and six patients lungs was performed as described previously (13–16). Thirty to fifty arteries per patient were collected; all arteries measured a diameter less than 500μm. Cryosections from lung tissue were mounted on glass slides; to limit storage time, only 10 slides were performed at time. After short haemalaun staining, intrapulmonary arteries were microdissected along the outer rim of arterial adventitia under optical control using the Laser Microbeam System (P.A.L.M., Bernried, Germany). Afterward, the vessel profiles were isolated by a sterile 30-gauge needle. Needles and adherent vessels were transferred into a reaction tube containing 200 μl of RNA lysis buffer. Total cellular RNA was isolated with the RNeasy kit (Qiagen, Valencia, CA) and purified according to the kit's protocol.
Equal amounts of RNA from three individuals each were pooled. Total RNA was reverse-transcribed, preamplified, and labeled using the BD Atlas SMART Fluorescent Probe Amplification Kit (Clontech Laboratories, Heidelberg, Germany) according to the kit's protocol. Total RNA (50 ng) was amplified with 24 cycles of SMART. The dsDNA products were labeled by four additional PCR cycles in the presence of aminoallylated UTP, and then coupled with monofunctional reactive Cy-dyes (Amersham, Freiburg, Germany). The labeled dsDNA was purified with the QIAquick PCR Purification Kit (Qiagen) following the kit instructions.
Absorbance spectra were measured with the ND-1000 (Nanodrop, Montchanin, DE). The concentrations of the nucleic acids (RNA, dsDNA) were estimated from the absorbance at 260 nm; absorbance values at 550 nm and 650 nm were used to calculate the amount of incorporated Cy3 and Cy5, respectively. Each sample was labeled once with Cy3 and once with Cy5. A dye-swap was performed to correct potential fluorescence labeling bias.
The labeled dsDNA containing 40 pmol incorporated Cy-dyes of each sample was subjected to hybridization. IPAH and donor samples were competitively hybridized on Agilent whole human genome arrays (Gene Expression Omnibus: G4112A) spotted with 44k 60 mer oligonucleotides according to Agilent's protocol (Version 4.1; Agilent, Santa Clara, CA). The hybridization was performed for 18 hours at 60°C while continuously rotating the Agilent hybridization chambers in a standard in situ hybridization oven. After hybridization, slides were washed according to the Agilent protocol.
Slides were scanned with the Axon 4100A (Molecular Devices, Munich, Germany). Photomultiplier tube (PMT) gains were adjusted to use the entire dynamic range of the scanner, yielding similar intensity histograms for both channels (Cy3 and Cy5). Image analysis was done with GenePix 5.0 (Molecular Devices), further data processing was performed using R and the limma package (17). Spots were weighted with factors between 0 (worst) and 1 (best) according to percentage of pixels with an intensity higher than the mean local background + 2 SD, homogeneity (coefficient of variation of the pixel intensities), and saturation (% pixels in saturation) for both channels. M and A values were calculated using the mean intensities. The M-versus-A values were normalized by a weighted LOESS correction (18). Candidate selection was based on a moderated t-statistic controlling the false discovery rate according to Hochberg and Benjamini (19). Genes were ranked for differential expression by a moderated Welsh-t-statistic (20). The selected 773 candidates were subjected to a pathway analysis using PathwayExpress (21). Pathways were ranked by the PathwayExpress impact factor. Pathways with impact factors greater than 1 and with more than three regulated genes were considered relevant.
The single-stranded cDNA templates for real-time RT-PCR analysis were generated from total RNA of different samples. Double-stranded DNA obtained after SMART preamplification directly served as template for subsequent real-time PCR.
Real-time PCR was performed using the ABI 7700 Sequence Detection System (Applied Biosystems, Foster City, CA) in 50-μl reactions containing 2 μl sample, 1× qPCR Mastermix for SYBR Green I (Eurogentec, Seraing, Belgium), and 45 pmol forward and reverse primer each. The primer sequences are given in Table 2.
Gene | Accession No.* | Product Length (base pairs) | Forward/Reverse Primers | Sequence (5′→3′) |
|---|---|---|---|---|
| WNT11 | NM_004626 | 91 | F | ACATGCGCTGGAACTGCT |
| R | GCATACACGAAGGCCGACTC | |||
| DSV1 | NM_181870.1 | 91 | F | ACATGTTGCTGCAGGTGAATG |
| R | CCCGTCTGGGAAACGATCT | |||
| RHOA | NM_001664.2 | 140 | F | CCATCATCCTGGTTGGGAAT |
| R | CATGTACCCAAAAGCGCCA | |||
| RAC1 | NM_018890.2 | 105 | F | ATCCGCAGGGTCTAGCCAT |
| R | GGATCGCTTCGTCAAACACTG | |||
| ROCK | BAA_75636 | 219 | F | TCGACAGCTTGCCCCAAA |
| R | GCTTCAAAGGAGCCCAGATTT | |||
| DAAM1 | NM_014992.1 | 104 | F | GATGGCCAAGGCTGATAGGTT |
| R | AGCCAGAACGAATTGCTTCC |
The cycling protocol was 1× (50°C, 2 min); 1× (95°C, 6 min); 45× (95°C, 20 s; 59°C, 30 s; 73°C, 30 s). Data for the amplification curves were acquired after the extension phase at 73°C. All samples were measured in duplicate. Amplification curves were evaluated using the instrument's software (SDS 1.7) according to the analysis standards given in the manual. The crossing point data (Ct values) were exported to spreadsheet software (Excel; Microsoft Corp., Redmond, WA) for further analysis. Reactions with Ct distance of less than three cycles to the buffer controls were excluded from analysis. Products obtained from real-time PCR were subjected to melting curve analysis and to agarose gel electrophoresis to check for the correct amplicon length and the absence of unspecific products. Transcript abundances were normalized to the expression of PBGD and expressed as ΔCt values (ΔCt = CtPBGD – Cttarget). Higher ΔCt values indicate a higher relative expression of the target gene. Box plots in figures show the median and interquartile range (IQR); whiskers are extended to the most extreme value within 1.5× of the IQR (22).
Formalin-fixed paraffin-embedded blocks of lung tissue from patients with IPAH and healthy donor patients were mounted on positively charged glass slides (R. Langenbrinck, Teningen, Germany). From each tissue block, 15 serial sections of 10 μm thickness were obtained, and immunohistochemistry (IHC) was performed using the APPAP complex method, with heat-induced epitope retrieval in citrate buffer. Anti–WNT-11 (R&D Systems, Minneapolis, MN), anti-DVL (R&D Systems,Minneapolis, USA), anti- RHOA (Abcam, ab 32,046), anti-RAC1 (ab13048; Abcam, Cambridge, UK), anti-ROCK (Abcam) were diluted in ChemMate Antibody Diluent, (Dako, Glostrup, Denmark). All antibodies were incubated over night at 4°C. Afterward, the slides were washed three times in TBS and incubated with species-specific secondary antibody 1:150 for 1 hour. After washing, alkaline phosphatase–conjugated anti-goat antibody (Rockland, Gilbertsville, PA) in dilution of 1:200 for 40 minutes was applied. Negative controls were performed with the omission of the first antibody. Slides from patients with IPAH and from the control group were always stained together to avoid systematic error.
For quantification of protein expression, all IHC slides were photographed with equal conditions. Using Adobe Photoshop 7.0 the immunohistochemical pictures were transferred to the lab color scale. Blue and yellow channels were erased to specifically determine the intensity of the red APPAP staining. The arteries were analyzed according to their size, for large arteries in layer-specific manner. Using the histogram function, a medium pixel intensity of the red chanel was recorded. This analysis was performed for at least 10 small arteries (50–100 μm) and all large arteries (∼ 500μm) for each section and further subjected to Wilcoxon signed-rank test. All analyses were done in a blinded fashion.
The following antibodies were used: rabbit polyclonal anti–β-Catenin (#9587; Cell Signaling, Danvers, MA), and polyclonal rabbit anti-N-Cadherin (Affinity BioReagents, Golden, CO) and monoclonal mouse anti–VE-Cadherin (Beckman Coulter, Krefeld, Germany). Secondary antibodies were labeled with Alexa-555 (Invitrogen, Carlsbad, CA). Paraffin-embedded human tissue was demasked using EDTA, deparaffinized with Rotihistol (Carl Roth, Karlsruhe, Germany) and blocked for 1 hour in 4% normal goat serum. Antibodies were diluted in Buffer containing 3% bovine serum albumin (BSA), 0.2% Triton X-100 in 1% BSA. The primary antibodies were incubated overnight at 4°C in a humidified chamber. Secondary antibodies were applied sequentially for 1 hour at room temperature. Nuclear staining was performed using To-Pro (Molecular Probes). After each incubation, the specimens were washed three times in PBS and finally mounted in Vectashield (Vector, Burlingame, CA). The stained slides were viewed with a laser scanning confocal microscope (TCS SP-2; Leica, Bensheim, Germany).
The complete microarray data can be downloaded from Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo/, accession number GSE10704).
Looking for overabundance of differentially regulated genes in known pathways can add structure to the genomic data. We performed an overexpression analysis of genes of pathways within Kyoto Encyclopedia of Genes and Genomes (KEGG). The pathway analysis of the 773 candidates identified several pathways overrepresented in our data (Table 3). Significant contributions of pathways involved in (1) extracellular matrix and cytoskeleton, (2) immune reaction, and (3) the WNT-signaling pathway were revealed. Because one of the WNT-signaling pathways, namely the planar cell polarity pathway, contains the RHO kinase (inhibitors of which are on the verge of clinical investigation in IPAH), we further focused on this signaling pathway. The microarray results for the identified WNT/PCP pathway genes are shown in Table 4.
KEGG-ID* | Pathway Name† | Impact Factor‡ | Input Genes in Pathway§ | Pathway Genes on Chip¶ |
|---|---|---|---|---|
| 1:04510 | Focal adhesion | 13.2 | 16 | 192 |
| 1:04520 | Adherens junction | 13.1 | 9 | 77 |
| 1:04530 | Tight junction | 9.4 | 8 | 116 |
| 1:04670 | Leukocyte transendothelial migration | 7.6 | 8 | 115 |
| 1:05130 | Pathogenic Escherichia coli infection | 7.0 | 5 | 49 |
| 1:04810 | Regulation of actin cytoskeleton | 5.6 | 10 | 203 |
| 1:04512 | ECM–receptor interaction | 4.6 | 5 | 86 |
| 1:04612 | Antigen processing and presentation | 4.1 | 4 | 66 |
| 1:04020 | Calcium signaling pathway | 3.4 | 5 | 172 |
| 1:04310 | WNT signaling pathway | 3.0 | 4 | 147 |
| 1:04010 | MAPK signaling pathway | 1.7 | 6 | 254 |
| 1:04060 | Cytokine-cytokine receptor interaction | 1.4 | 4 | 246 |
Symbol | GenBank Accession No. | Coefficient* | A.mean† | Gene Name |
|---|---|---|---|---|
| RAC1 | NM_198829 | 0.25 | 7.91 | ras-related C3 botulinum toxin substrate 1 |
| RHOA | NM_001664 | 0.218 | 8.78 | ras homolog gene family, member A |
| SKP1A | NM_170679 | 0.249 | 9.9 | S-phase kinase-associated protein 1A (p19A) |
| WNT6 | NM_006522 | −0.354 | 10.37 | wingless-type MMTV integration site family, member 6 |
In addition to those genes of the PCP-pathway (DAAM1, RAC1, RHOA) that were found to be differentially regulated in the microarray study, the further mediators WNT11, ROCK, and DSV of this pathway were analyzed by real-time RT-PCR using RNA extracted freshly from laser-microdissected vessels (n = 6 patients and donors per group). A schematic overview of this pathway is depicted in Figure 1. The real-time PCR results are shown in Figure 2. WNT11 up-regulation was highest with a ΔΔCt value of 5.0 ± 0.8, followed by RHOA (4.3 ± 1.6), RAC1 (3.8 ± 1.0), ROCK (3.2 ± 0.7), DAAM1 (2.4 ± 0.3), and DSV (1.8 ± 0.8). Statistics were performed using the Welsh t test (two-sided); means ± SEM are shown.
Figure 1. Schematic picture of the Planar Cell Polarity Pathway: WNT11 acts via the transmembrane proteins FRIZZLED and DISHEVELLED, thereby activating RHOA and RAC1 and downstream, the RHO kinase (ROCK) and JNK kinase (JNK). Picture adapted from Kyoto Encyclopedia of Genes and Genomes (67–69).
[More] [Minimize]
Figure 2. Validation of microarray results by real-time RT-PCR. Arteries from six patients with idiopathic pulmonary arterial hypertension (IPAH) and six donors were laser-microdissected, and obtained mRNA was analyzed for selected mediators of the planar cell polartity pathway. ΔCt values are shown. Statistical analysis was performed using two-sided t test (*P ≤ 0.05).
[More] [Minimize]The expression of genes of the PCP pathway was further evaluated by immunohistochemistry analysis of paraffin sections from four IPAH lungs and four donor lungs. In all IPAH lungs, specific immune reactivity for the selected proteins was observed in the vascular compartment. Immunostaining was more prominent for all PCP pathway proteins investigated in small pulmonary arterioles in IPAH lungs compared with healthy donor lungs (Figure 3). Semiquantitative analysis showed a significant increase of all mediators except DSV (Figure 4).
Figure 3. Immunohistochemistry of small pulmonary resistance arteries from IPAH lungs (a–f) and donor lungs (g–l). Shown are immunostainings in purple/red for WNT11 (a, g), DSV (b, h), RHO (c, i), RAC1 (d, j), ROCK (e, k), and negative controls (f, l). The proteins of the PCP pathway are more strongly expressed in the intimal and medial layer of pulmonary resistance arteries of patients with IPAH compared with healthy lung. Original magnification: ×20 (bar = 100 μm).
[More] [Minimize]
Figure 4. Semiquantitative analysis of protein expressions of small pulmonary resistance arteries. At least 20 arteries from each individual were analyzed for their individual red/purple staining. Mean staining intensities of all selected PCP pathway mediators was higher in idiopathic PAH compared with healthy control tissue. Y-axis shows arbitrary units for color intensity. Statistical analysis was done with Wilcoxon test (*P ≤ 0.05).
[More] [Minimize]In conducting pulmonary arteries, PCP pathway protein expression was mainly found in the endothelium (Figure 5). Semiquantitative analysis of the color intensities revealed significant differences in the protein expression in different vessel layers. Only WNT11 was significantly up-regulated in all three layers (Figure 6). Protein expression of investigated proteins was not significant in the media (Figure 6, middle panel). Most proteins showed a significant overexpression in the adventitia, but overall on a much lower expression level than the endothelium (Figure 6, lower panel).
Figure 5. Immunohistochemistry of large arteries (> 500μm) from IPAH lungs. Magnifications are 20-fold (a–f) (bar = 100 μm). Panels a′–f′ on the right side show a magnification of the original pictures on the left. Immunostainings show in purple/red WNT11 (a, a′), DSV (b, b′), RHO (c, c′), RAC1 (d, d′), ROCK (e, e′), negative control (f, f′). WNT11, RHO and ROCK are expressed in the endothelial layer of conducting pulmonary arteries in IPAH.
[More] [Minimize]
Figure 6. Semiquantitative analysis of immunohistochemical staining of large arteries (< 500μm). At least five arteries from each individual were analyzed. Mean staining intensity of selected PCP pathway mediators of each vessel layer is shown in idiopathic PAH compared with healthy control tissue. Y-axis shows arbitrary units for color intensity. Statistical analysis was done with Wilcoxon test (*P ≤ 0.05).
[More] [Minimize]WNT11 signaling is known to promote internalization of E-cadherin in the progress of epithelial to mesenchymal transition (23), and RAC1 activation is known to control nuclear activation of β-catenin (24); we investigated the expression levels and patterns of β-catenin, VE-cadherin, and N-cadherin. In laser-microdissected arteries, β-catenin was significantly up-regulated in IPAH lungs. Immunofluorescent staining for β-catenin and analysis by confocal microscopy showed cytoplasmatic, endothelial cell restricted expression of β-catenin in control and IPAH lungs. In analogy to the PCR findings, immunostaining appeared more prominent in IPAH lungs (see Figure E1 in the online supplement). These findings are in line with the concept of coactivation of the canonical and noncanonical WNT-pathway in IPAH.
Concerning signs of endothelial–mesenchymal transition, real-time PCR analysis for N-cadherin showed a nonsignificant tendency to higher expression levels in IPAH (n = 6, P = 0.09) which does not fit to the concept of down-regulation of adherens junctions as a part of the transition process. N-cadherin expression pattern was in accordance to cell–junctional expression. We could not detect a difference in the expression pattern in control versus IPAH tissue.
VE-cadherin was not regulated on gene expression level; we could not detect changes in expression pattern as well (data not shown).
Idiopathic pulmonary arterial hypertension is a fatal disease and its pathogenesis, despite extensive research efforts, is still incompletely understood. A variety of mediators so far has been identified that may at least modulate the pulmonary vascular remodeling and disease progression in animal models. These pathways include prostacyclin (25), nitric oxide (26), endothelin-1 (27), the serotonin-transporter (28), vascular endothelial growth factor (29), platelet derived growth factor-BB (30), phosphodiesterase-1c, -3, -4, and -5 (31–33), epidermal growth factor (9), membrane ion channels (34, 35), the transcription factor survivin (8), and the S100A4 protein (14, 36, 37). Three out of these pathways have already been translated into approved clinical drug applications that target prostacyclin receptors (38, 39), endothelin-1 receptors (40), or the nitric oxide second messenger cyclic guanosine monophosphate (41). New targets under current clinical investigation are receptor kinases that permeate cellular responses to growth factors (42).
Most of the known mediators in IPAH pathogenesis have been discovered either by chance or by hypothesis-driven investigations. Recently, the emerging techniques of functional genomics opened new possibilities to allocate as yet unanticipated pathways or genes that may be involved in disease onset and progression. Microarray techniques have already been successfully applied in the field of oncology to assess differential gene expression and thereby detect subclassifications relevant for therapy and prognosis (43–45).
Concerning idiopathic PAH, gene expression profiling has been applied to whole lung homogenate or primary cells from IPAH lungs or circulation. Geraci and coworkers analyzed differential gene expression of lung homogenate obtained from patients with IPAH and familial PAH in comparison to that obtained from healthy donors. From this study it was reported that gene expression differed significantly between familial and idiopathic PAH (46). A microarray analysis of peripheral blood mononuclear cells allowed, based on distinct expression patterns, the differentiation of healthy persons and patients with PAH (47). Consistent with our data, RAC1 was found to be up-regulated in patients with PAH. Expression profiling of primary pulmonary artery smooth muscle cells from IPAH and healthy lungs showed differential regulations in response to BMP-2 stimulation (48). Recently, the technique of suppression subtractive hybridization was applied to lung homogenate from IPAH and healthy donors and derived a set of 27 up-regulated genes in IPAH (49). None of these genes overlapped with our 773 regulated genes. This might be due to statistical limitations or the purity level of the tissues used.
One major drawback of studies on lung homogenate is due to the fact that IPAH is a disease of the small pulmonary arteries. However, resistance vessels are only a minor fraction of whole lung tissue, and it is conceivable that expression changes in the pulmonary vasculature may not be depicted by investigation of whole lung homogenate (10, 13). Previously our group could show that the combination of laser-assisted cell picking and expression profiling is feasible and representative of the targeted tissue fraction (11, 14, 16). As expected, expression profiling of compartment specific analysis and lung homogenate differed remarkably.
The present study therefore focused on laser-microdissected small arteries for the analysis of gene expression in patients with IPAH. Following statistical analysis and ranking based on significance of regulation, genes were subjected to a pathway analysis tool that categorizes clusters of related genes into pathways or functions.
Because of the incorporated pre-amplification step, a careful interpretation of the ranked genes is necessary. The order of the involved pathways that is calculated by their impact factor might thus not be correctly mirrored. Nevertheless, the expressional changes suggested by the array experiments were confirmed by quantitative PCR in nonamplified, laser-microdissected material. By real-time RT-PCR, we even found additional regulated genes of the PCP pathway that, due to statistical restrictions, could not be directly derived from the arrays. Immunohistochemistry confirmed not only the expression on protein level but also the vascular localization. To analyze the compartment-specific regulation on protein level, we performed a semiquantitative analysis, because dissected material could not provide enough protein for a Western blot analysis, and confirmed the regulations of the PCP mediators also on protein level. Most investigated PCP mediators were also strongly expressed in the bronchial endothelium, where expression levels did not differ between patients with IPAH and control subjects (data not shown), again underlining the inappropriateness of homogenate for expression profiling.
A limitation of this study is the relatively small number of sample tissues analyzed (n = 6 for each group in microarray analysis and real-time-PCR, n = 4 in immunohistochemical analysis). This was due to the fact that (1) human lung tissue with optimal preprocessing for mRNA isolation (shock-frozen directly following lung explantation) could only be obtained in limited numbers for this study, and (2) laser microdissection of pulmonary resistance arteries is an extremely time-consuming procedure.
The WNT family of secreted glycoproteins comprises so far 19 known ligands that control a broad variety of biological processes, including cell fate specification, polarity, migration, and proliferation. WNT signaling was shown to be critically involved in lung development (50) as well as in pulmonary diseases like fibrosis (51) and tumor formation (52). Three WNT-associated pathways are known: (1) the canonical (β-catenin–dependent), (2) the noncanonical PCP or c-jun N-terminal kinase (JNK)/activating protein (AP) 1 pathway, and (3) the PKC/calmodulin kinase/nuclear factor of activated T cells (NFAT)-dependent pathway. The interactions of WNT ligands and frizzled receptors are somewhat but not strictly pathway specific (WNT-1, -3, -3a, -7a, -7b, and -8 for the canonical and WNT-4, -5a, and -11 for the noncanonical), rendering the analysis of WNT actions complex (53). During lung development, canonical WNT-signaling influences significantly the generation of peripheral airways and alveolar space, whereas it is dispensable for proximal bronchial branching (50, 54). Less data exist on the noncanonical WNT pathways. In WNT-5a−/− mice, body growth as well as lung growth and alveolarization were delayed (55). WNT-5a seemed to control expression levels of FGF-10 and bone morphogenetic protein (BMP) 4 during lung development, two central growth factors for lung bud branching and cell proliferation. Expression of the noncanonical ligand WNT-11 has been mapped to lung epithelium and mesenchyme during development (56).
It is a general concept that canonical WNT-signaling via β-catenin maintains cells in a low differentiation/high proliferation state. We found β-catenin expression in endothelial cells of pulmonary arteries with higher expression levels in patients with IPAH compared with control subjects. The noncanonical mediator WNT-5a was described to counteract canonical WNT signaling. However, WNT-5a was found to be up-regulated in metastatic lung tumor (57) and is suspected to induce epithelial–mesenchymal transition in lung tumorigenesis (58). This would be in line with our findings of up-regulated PCP pathway members in pulmonary resistance arteries, which undergo progressive vascular remodeling in idiopathic PAH. These findings in lung tumors suggest a pro-proliferative role of the noncanonical PCP pathway in adult lung tissue.
One important step of vascular remodeling is the transition of endothelial cells into mesenchymal-like cells, a developmental process that requires loss of endothelial cell–cell contacts and restructuring of cytoskeleton (59). It is known that WNT11 can internalize E-cadherin and thereby destabilize cell–cell contacts in epithelial–mesenchymal transition (23). In analogy of the role of E-cadherin as major determinant for epithelial cell contact integrity, we investigated the expression pattern of VE-cadherin and N-cadherin, the major cadherins present in endothelial cells. VE-cadherin is an adhesion molecule that is known to regulate various cellular processes such as cell proliferation and apoptosis and to modulate vascular endothelial growth factor receptor functions (60). We could not find changes in expression levels or patterns of E-cadherin in pulmonary arteries. N-cadherin plays an essential role in the maturation and stabilization of normal vessels and tumor-associated angiogenic vessels (60). We found a nonsignificant up-regulation of N-cadherin in IPAH contradicting a prominent loss of adherens junctions.
Some members of this pathway (ROCK, RHOA) have already been investigated in terms of pulmonary hypertension. RHO kinase phosphorylates myosin light chain phosphatase and thereby inhibits its phosphatase activity, leading to maintenance of smooth muscle actin–myosin interaction and contraction. RHO kinase inhibitors have been applied to rats with monocrotalin-induced pulmonary hypertension and reduced mortality and severity of disease (61). The RHO kinase inhibitor fasudil has been applied to patients with PAH as a single-dose infusion during right heart catheterization and potently induced acute pulmonary vasodilatation (62, 63). Statins inhibit RHOA geranylgeranylation and reduce active GTP-bound RHOA. Therefore statins have also been suggested as specific therapy for PAH (64, 65). Clinical trials investigating statins in PAH are currently ongoing. Furthermore, it has been reported earlier that β-catenin was found in nuclear location in many cases of IPAH, underlining the importance of the WNT system in PAH pathogenesis (66).
In conclusion, we presented for the first time compartment specific expression profiling of pulmonary resistance arteries in human idiopathic pulmonary arterial hypertension. We derived several putatively altered signaling pathways out of which we validated the expressional changes for a noncanonical WNT pathway. The overexpression of several mediators of the PCP pathway suggests a role in pulmonary vascular remodeling and IPAH progression. In addition, some mediators of the canonical WNT pathway were operative in IPAH, suggesting a more complex WNT signaling network in the process of pulmonary vascular remodeling. Further functional studies will be needed to dissect the contributions of the canonical and the noncanonical WNT pathway to IPAH pathogenesis.
| 1. | Rubin LJ. Primary pulmonary hypertension. N Engl J Med 1997;336:111–117. |
| 2. | Rich S, Dantzker DR, Ayres SM, Bergofsky EH, Brundage BH, Detre KM, Fishman AP, Goldring RM, Groves BM, Koerner SK, et al. Primary pulmonary hypertension: a national prospective study. Ann Intern Med 1987;107:216–223. |
| 3. | Durmowicz AG, Stenmark KR. Mechanisms of structural remodeling in chronic pulmonary hypertension. Pediatr Rev 1999;20:e91–e102. |
| 4. | Hopkins N, McLoughlin P. The structural basis of pulmonary hypertension in chronic lung disease: remodelling, rarefaction or angiogenesis? J Anat 2002;201:335–348. |
| 5. | Lane KB, Machado RD, Pauciulo MW, Thomson JR, Phillips JA III, Loyd JE, Nichols WC, Trembath RC. Heterozygous germline mutations in bmpr2, encoding a TGF-beta receptor, cause familial primary pulmonary hypertension: the international PPH consortium. Nat Genet 2000;26:81–84. |
| 6. | Deng Z, Morse JH, Slager SL, Cuervo N, Moore KJ, Venetos G, Kalachikov S, Cayanis E, Fischer SG, Barst RJ, et al. Familial primary pulmonary hypertension (gene PPH1) is caused by mutations in the bone morphogenetic protein receptor-II gene. Am J Hum Genet 2000;67:737–744. |
| 7. | Souza R, Sitbon O, Parent F, Simonneau G, Humbert M. Long term imatinib treatment in pulmonary arterial hypertension. Thorax 2006;61:736. |
| 8. | McMurtry MS, Archer SL, Altieri DC, Bonnet S, Haromy A, Harry G, Puttagunta L, Michelakis ED. Gene therapy targeting survivin selectively induces pulmonary vascular apoptosis and reverses pulmonary arterial hypertension. J Clin Invest 2005;115:1479–1491. |
| 9. | Merklinger SL, Jones PL, Martinez EC, Rabinovitch M. Epidermal growth factor receptor blockade mediates smooth muscle cell apoptosis and improves survival in rats with pulmonary hypertension. Circulation 2005;112:423–431. |
| 10. | Fink L, Kohlhoff S, Stein MM, Hanze J, Weissmann N, Rose F, Akkayagil E, Manz D, Grimminger F, Seeger W, et al. Cdna array hybridization after laser-assisted microdissection from nonneoplastic tissue. Am J Pathol 2002;160:81–90. |
| 11. | Fink L, Seeger W, Ermert L, Hanze J, Stahl U, Grimminger F, Kummer W, Bohle RM. Real-time quantitative rt-pcr after laser-assisted cell picking. Nat Med 1998;4:1329–1333. |
| 12. | Heath D, Edwards JE. The pathology of hypertensive pulmonary vascular disease; a description of six grades of structural changes in the pulmonary arteries with special reference to congenital cardiac septal defects. Circulation 1958;18:533–547. |
| 13. | Fink L, Kwapiszewska G, Wilhelm J, Bohle RM. Laser-microdissection for cell type- and compartment-specific analyses on genomic and proteomic level. Exp Toxicol Pathol 2006;57:25–29. |
| 14. | Kwapiszewska G, Wilhelm J, Wolff S, Laumanns I, Koenig IR, Ziegler A, Seeger W, Bohle RM, Weissmann N, Fink L. Expression profiling of laser-microdissected intrapulmonary arteries in hypoxia-induced pulmonary hypertension. Respir Res 2005;6:109. |
| 15. | Fink L, Bohle RM. Laser microdissection and RNA analysis. Methods Mol Biol 2005;293:167–185. |
| 16. | Kwapiszewska G, Meyer M, Bogumil R, Bohle RM, Seeger W, Weissmann N, Fink L. Identification of proteins in laser-microdissected small cell numbers by SELDI-TOF and tandem MS. BMC Biotechnol 2004;4:30. |
| 17. | Smyth GK. Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Stat Appl Genet Mol Biol 2004;3:Article3:1–25. |
| 18. | Wettenhall JM, Smyth GK. Limmagui: a graphical user interface for linear modeling of microarray data. Bioinformatics 2004;20:3705–3706. |
| 19. | Hochberg Y, Benjamini Y. More powerful procedures for multiple significance testing. Stat Med 1990;9:811–818. |
| 20. | Welch B. The generalization of “Student's” Problem when several different population variances are involved. Biometrika 1947;34:28–35. |
| 21. | Khatri P, Voichita C, Kattan K, Ansari N, Khatri A, Georgescu C, Tarca AL, Draghici S. Onto-tools: new additions and improvements in 2006. Nucleic Acids Res 2007;35(Web Server issue):W206–W211. |
| 22. | Tukey J. Exploratory data analysis. Princeton: Addison-Wesley; 1977. |
| 23. | Ouko L, Ziegler TR, Gu LH, Eisenberg LM, Yang VW. WNT11 signaling promotes proliferation, transformation, and migration of IEC6 intestinal epithelial cells. J Biol Chem 2004;279:26707–26715. |
| 24. | Wu X, Tu X, Joeng KS, Hilton MJ, Williams DA, Long F. Rac1 activation controls nuclear localization of beta-catenin during canonical WNT signaling. Cell 2008;133:340–353. |
| 25. | Rubin LJ, Groves BM, Reeves JT, Frosolono M, Handel F, Cato AE. Prostacyclin-induced acute pulmonary vasodilation in primary pulmonary hypertension. Circulation 1982;66:334–338. |
| 26. | Giaid A, Saleh D. Reduced expression of endothelial nitric oxide synthase in the lungs of patients with pulmonary hypertension. N Engl J Med 1995;333:214–221. |
| 27. | Wort SJ, Woods M, Warner TD, Evans TW, Mitchell JA. Endogenously released endothelin-1 from human pulmonary artery smooth muscle promotes cellular proliferation: relevance to pathogenesis of pulmonary hypertension and vascular remodeling. Am J Respir Cell Mol Biol 2001;25:104–110. |
| 28. | Eddahibi S, Humbert M, Fadel E, Raffestin B, Darmon M, Capron F, Simonneau G, Dartevelle P, Hamon M, Adnot S. Serotonin transporter overexpression is responsible for pulmonary artery smooth muscle hyperplasia in primary pulmonary hypertension. J Clin Invest 2001;108:1141–1150. |
| 29. | Voelkel NF, Hoeper M, Maloney J, Tuder RM. Vascular endothelial growth factor in pulmonary hypertension. Ann N Y Acad Sci 1996;796:186–193. |
| 30. | Schermuly RT, Dony E, Ghofrani HA, Pullamsetti S, Savai R, Roth M, Sydykov A, Lai YJ, Weissmann N, Seeger W, et al. Reversal of experimental pulmonary hypertension by PDGF inhibition. J Clin Invest 2005;115:2811–2821. |
| 31. | Schermuly RT, Pullamsetti SS, Kwapiszewska G, Dumitrascu R, Tian X, Weissmann N, Ghofrani HA, Kaulen C, Dunkern T, Schudt C, et al. Phosphodiesterase 1 upregulation in pulmonary arterial hypertension: target for reverse-remodeling therapy. Circulation 2007;115:2331–2339. |
| 32. | Schermuly RT, Kreisselmeier KP, Ghofrani HA, Yilmaz H, Butrous G, Ermert L, Ermert M, Weissmann N, Rose F, Guenther A, et al. Chronic sildenafil treatment inhibits monocrotaline-induced pulmonary hypertension in rats. Am J Respir Crit Care Med 2004;169:39–45. |
| 33. | Ghofrani HA, Rose F, Schermuly RT, Olschewski H, Wiedemann R, Weissmann N, Schudt C, Tenor H, Seeger W, Grimminger F. Amplification of the pulmonary vasodilatory response to inhaled iloprost by subthreshold phosphodiesterase types 3 and 4 inhibition in severe pulmonary hypertension. Crit Care Med 2002;30:2489–2492. |
| 34. | Weissmann N, Dietrich A, Fuchs B, Kalwa H, Ay M, Dumitrascu R, Olschewski A, Storch U, Mederos y Schnitzler M, Ghofrani HA, et al. Classical transient receptor potential channel 6 (trpc6) is essential for hypoxic pulmonary vasoconstriction and alveolar gas exchange. Proc Natl Acad Sci USA 2006;103:19093–19098. |
| 35. | Moudgil R, Michelakis ED, Archer SL. The role of k+ channels in determining pulmonary vascular tone, oxygen sensing, cell proliferation, and apoptosis: Implications in hypoxic pulmonary vasoconstriction and pulmonary arterial hypertension. Microcirculation 2006;13:615–632. |
| 36. | . Merklinger SL, Wagner RA, Spiekerkoetter E, Hinek A, Knutsen RH, Kabir MG, Desai K, Hacker S, Wang L, Cann GM, et al. Increased fibulin-5 and elastin in s100a4/mts1 mice with pulmonary hypertension. Circ Res 2005;97:596–604. |
| 37. | Spiekerkoetter E, Lawrie A, Merklinger S, Ambartsumian N, Lukanidin E, Schmidt AM, Rabinovitch M. Mts1/s100a4 stimulates human pulmonary artery smooth muscle cell migration through multiple signaling pathways. Chest 2005;128:577S. |
| 38. | Olschewski H, Rose F, Schermuly R, Ghofrani HA, Enke B, Olschewski A, Seeger W. Prostacyclin and its analogues in the treatment of pulmonary hypertension. Pharmacol Ther 2004;102:139–153. |
| 39. | Rubin LJ, Mendoza J, Hood M, McGoon M, Barst R, Williams WB, Diehl JH, Crow J, Long W. Treatment of primary pulmonary hypertension with continuous intravenous prostacyclin (epoprostenol): results of a randomized trial. Ann Intern Med 1990;112:485–491. |
| 40. | Rubin LJ, Badesch DB, Barst RJ, Galie N, Black CM, Keogh A, Pulido T, Frost A, Roux S, Leconte I, et al. Bosentan therapy for pulmonary arterial hypertension. N Engl J Med 2002;346:896–903. |
| 41. | Galie N, Ghofrani HA, Torbicki A, Barst RJ, Rubin LJ, Badesch D, Fleming T, Parpia T, Burgess G, Branzi A, et al. Sildenafil citrate therapy for pulmonary arterial hypertension. N Engl J Med 2005;353:2148–2157. |
| 42. | Ghofrani HA, Seeger W, Grimminger F. Imatinib for the treatment of pulmonary arterial hypertension. N Engl J Med 2005;353:1412–1413. |
| 43. | Bullinger L, Dohner K, Bair E, Frohling S, Schlenk RF, Tibshirani R, Dohner H, Pollack JR. Use of gene-expression profiling to identify prognostic subclasses in adult acute myeloid leukemia. N Engl J Med 2004;350:1605–1616. |
| 44. | Khan J, Wei JS, Ringner M, Saal LH, Ladanyi M, Westermann F, Berthold F, Schwab M, Antonescu CR, Peterson C, et al. Classification and diagnostic prediction of cancers using gene expression profiling and artificial neural networks. Nat Med 2001;7:673–679. |
| 45. | Valk PJ, Verhaak RG, Beijen MA, Erpelinck CA, Barjesteh van Waalwijk van Doorn-Khosrovani S, Boer JM, Beverloo HB, Moorhouse MJ, van der Spek PJ, Lowenberg B, et al. Prognostically useful gene-expression profiles in acute myeloid leukemia. N Engl J Med 2004;350:1617–1628. |
| 46. | Geraci MW, Moore M, Gesell T, Yeager ME, Alger L, Golpon H, Gao B, Loyd JE, Tuder RM, Voelkel NF. Gene expression patterns in the lungs of patients with primary pulmonary hypertension: a gene microarray analysis. Circ Res 2001;88:555–562. |
| 47. | Bull TM, Coldren CD, Moore M, Sotto-Santiago SM, Pham DV, Nana-Sinkam SP, Voelkel NF, Geraci MW. Gene microarray analysis of peripheral blood cells in pulmonary arterial hypertension. Am J Respir Crit Care Med 2004;170:911–919. |
| 48. | Fantozzi I, Huang W, Zhang J, Zhang S, Platoshyn O, Remillard CV, Thistlethwaite PA, Yuan JX. Divergent effects of bmp-2 on gene expression in pulmonary artery smooth muscle cells from normal subjects and patients with idiopathic pulmonary arterial hypertension. Exp Lung Res 2005;31:783–806. |
| 49. | Edgar AJ, Chacon MR, Bishop AE, Yacoub MH, Polak JM. Upregulated genes in sporadic, idiopathic pulmonary arterial hypertension. Respir Res 2006;7:1. |
| 50. | Okubo T, Hogan BL. Hyperactive WNT signaling changes the developmental potential of embryonic lung endoderm. J Biol 2004;3:11. |
| 51. | Kim K, Lu Z, Hay ED. Direct evidence for a role of beta-catenin/LEF-1 signaling pathway in induction of EMT. Cell Biol Int 2002;26:463–476. |
| 52. | Kotsinas A, Evangelou K, Zacharatos P, Kittas C, Gorgoulis VG. Proliferation, but not apoptosis, is associated with distinct beta-catenin expression patterns in non-small-cell lung carcinomas: relationship with adenomatous polyposis coli and g(1)-to s-phase cell-cycle regulators. Am J Pathol 2002;161:1619–1634. |
| 53. | Torres MA, Yang-Snyder JA, Purcell SM, DeMarais AA, McGrew LL, Moon RT. Activities of the WNT-1 class of secreted signaling factors are antagonized by the WNT-5a class and by a dominant negative cadherin in early Xenopus development. J Cell Biol 1996;133:1123–1137. |
| 54. | Mucenski ML, Wert SE, Nation JM, Loudy DE, Huelsken J, Birchmeier W, Morrisey EE, Whitsett JA. Beta-catenin is required for specification of proximal/distal cell fate during lung morphogenesis. J Biol Chem 2003;278:40231–40238. |
| 55. | Li C, Xiao J, Hormi K, Borok Z, Minoo P. WNT5a participates in distal lung morphogenesis. Dev Biol 2002;248:68–81. |
| 56. | Lako M, Strachan T, Bullen P, Wilson DI, Robson SC, Lindsay S. Isolation, characterisation and embryonic expression of WNT11, a gene which maps to 11q13.5 and has possible roles in the development of skeleton, kidney and lung. Gene 1998;219:101–110. |
| 57. | Nakano T, Tani M, Ishibashi Y, Kimura K, Park YB, Imaizumi N, Tsuda H, Aoyagi K, Sasaki H, Ohwada S, et al. Biological properties and gene expression associated with metastatic potential of human osteosarcoma. Clin Exp Metastasis 2003;20:665–674. |
| 58. | Pongracz JE, Stockley RA. WNT signalling in lung development and diseases. Respir Res 2006;7:15. |
| 59. | Potenta S, Zeisberg E, Kalluri R. The role of endothelial-to-mesenchymal transition in cancer progression. Br J Cancer 2008;99:1375–1379. |
| 60. | Liebner S, Cavallaro U, Dejana E. The multiple languages of endothelial cell-to-cell communication. Arterioscler Thromb Vasc Biol 2006;26:1431–1438. |
| 61. | Abe K, Shimokawa H, Morikawa K, Uwatoku T, Oi K, Matsumoto Y, Hattori T, Nakashima Y, Kaibuchi K, Sueishi K, et al. Long-term treatment with a rho-kinase inhibitor improves monocrotaline-induced fatal pulmonary hypertension in rats. Circ Res 2004;94:385–393. |
| 62. | Fukumoto Y, Matoba T, Ito A, Tanaka H, Kishi T, Hayashidani S, Abe K, Takeshita A, Shimokawa H. Acute vasodilator effects of a rho-kinase inhibitor, fasudil, in patients with severe pulmonary hypertension. Heart 2005;91:391–392. |
| 63. | Ishikura K, Yamada N, Ito M, Ota S, Nakamura M, Isaka N, Nakano T. Beneficial acute effects of rho-kinase inhibitor in patients with pulmonary arterial hypertension. Circ J 2006;70:174–178. |
| 64. | Taraseviciene-Stewart L, Scerbavicius R, Choe KH, Cool C, Wood K, Tuder RM, Burns N, Kasper M, Voelkel NF. Simvastatin causes endothelial cell apoptosis and attenuates severe pulmonary hypertension. Am J Physiol Lung Cell Mol Physiol 2006;291:L668–L676. |
| 65. | Guerard P, Rakotoniaina Z, Goirand F, Rochette L, Dumas M, Lirussi F, Bardou M. The hmg-coa reductase inhibitor, pravastatin, prevents the development of monocrotaline-induced pulmonary hypertension in the rat through reduction of endothelial cell apoptosis and overexpression of enos. Naunyn Schmiedebergs Arch Pharmacol 2006;373:401–414. |
| 66. | Chilosi M, Poletti V, Zamo A, Lestani M, Montagna L, Piccoli P, Pedron S, Bertaso M, Scarpa A, Murer B, et al. Aberrant wnt/beta-catenin pathway activation in idiopathic pulmonary fibrosis. Am J Pathol 2003;162:1495–1502. |
| 67. | Kanehisa M, Goto S. KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res 2000;28:27–30. |
| 68. | Kanehisa M, Goto S, Hattori M, Aoki-Kinoshita KF, Itoh M, Kawashima S, Katayama T, Araki M, Hirakawa M. From genomics to chemical genomics: new developments in KEGG. Nucleic Acids Res 2006;34:D354–D357. |
| 69. | Kanehisa M, Araki M, Goto S, Hattori M, Hirakawa M, Itoh M, Katayama T, Kawashima S, Okuda S, Tokimatsu T, et al. KEGG for linking genomes to life and the environment. Nucleic Acids Res 2008;36:D480–D484. |
