American Journal of Respiratory and Critical Care Medicine

Rationale: Germline mutations in the gene encoding for bone morphogenetic protein receptor 2 (BMPR2) are a cause of pulmonary arterial hypertension (PAH).

Objectives: We conducted a study to determine the influence, if any, of a BMPR2 mutation on clinical outcome.

Methods: The French Network of Pulmonary Hypertension obtained data for 223 consecutive patients displaying idiopathic or familial PAH in whom point mutation and large size rearrangements of BMPR2 were screened for. Clinical, functional, and hemodynamic characteristics, as well as outcomes, were compared in BMPR2 mutation carriers and noncarriers.

Measurements and Main Results: Sixty-eight BMPR2 mutation carriers (28 familial and 40 idiopathic PAH) were compared with 155 noncarriers (all displaying idiopathic PAH). As compared with noncarriers, BMPR2 mutation carriers were younger at diagnosis of PAH (36.5 ± 14.5 vs. 46.0 ± 16.1 yr, P < 0.0001), had higher mean pulmonary artery pressure (64 ± 13 vs. 56 ± 13 mm Hg, P < 0.0001), lower cardiac index (2.13 ± 0.68 vs. 2.50 ± 0.73 L/min/m2, P = 0.0005), higher pulmonary vascular resistance (17.4 ± 6.1 vs. 12.7 ± 6.6 mm Hg/L/min/m2, P < 0.0001), lower mixed venous oxygen saturation (59 ± 9% vs. 63 ± 9%, P = 0.02), shorter time to death or lung transplantation (P = 0.044), and younger age at death (P = 0.002), but similar overall survival (P = 0.51).

Conclusions: BMPR2 mutation carriers with PAH present approximately 10 years earlier than noncarriers, with a more severe hemodynamic compromise at diagnosis.

Scientific Knowledge on the Subject

Germline mutations in the gene encoding for bone morphogenetic protein receptor 2 (BMPR2) are a cause of pulmonary arterial hypertension. The influence, if any, of a BMPR2 mutation on clinical outcomes is currently unknown.

What This Study Adds to the Field

BMPR2 mutation carriers with pulmonary arterial hypertension present approximately 10 years earlier than noncarriers with a more severe hemodynamic compromise at diagnosis.

Pulmonary arterial hypertension (PAH) is a severe disease affecting small pulmonary arteries, with a progressive remodeling leading to elevated pulmonary vascular resistance and right ventricular failure (1). PAH may occur in different clinical contexts, depending on associated clinical conditions (1, 2). Idiopathic PAH corresponds to sporadic disease, without any familial history of PAH or known triggering factor (2). When PAH occurs in a familial context (25), germline mutations in the bone morphogenetic protein receptor 2 (BMPR2) gene are detected in at least 70% of cases (610). BMPR2 mutations can also be detected in 11 to 40% of apparently sporadic cases (1015). The distinction between idiopathic and familial BMPR2 mutation carriers may in fact be artificial, as these subjects have an inherited condition and may all correspond to a potential familial disease. Recent expert discussion pleads in favor of the term “heritable” PAH to describe these genetic forms of the disease. In any case, BMPR2 mutation represents the major genetic predisposing factor for PAH (617).

The BMPR2 gene encodes a type 2 receptor for bone morphogenetic proteins, which belong to the transforming growth factor-β superfamily (16). Among several biological functions, bone morphogenetic proteins are involved in the control of vascular cell proliferation (16). Heterozygous inactivating mutations of BMPR2 are responsible for functional haploinsufficiency of the bone morphogenetic proteins' transduction pathway, and lead to proliferation of smooth muscle cells within pulmonary arteries (17). However, the penetrance of BMPR2 mutations is low (around 20%), and neither the factors involved in the initiation of the disease in affected subjects nor the precise molecular mechanisms underlying the responsibility of BMPR2 haploinsufficiency in the disease are identified (5, 16, 17). Previous reports have suggested that the clinical and hemodynamic presentation of familial PAH was not different from idiopathic PAH, with similar pathologic lesions as well as molecular and cellular abnormalities described in both subtypes (16, 18). However, a significant proportion of so-called idiopathic cases were in fact associated with BMPR2 mutations and this might have given a biased comparison (11). Recent findings have indicated that BMPR2 mutation carriers with familial or idiopathic PAH were less likely to display vasoreactivity than noncarriers, raising the possibility that monoallelic BMPR2 mutation identifies patients who may respond poorly to long-term vasodilator therapy (19).

We hypothesized that a mutated BMPR2 status is associated with distinct disease phenotypes. To test this hypothesis, the French Network of Pulmonary Hypertension obtained data on consecutive patients displaying idiopathic or familial PAH in whom point mutation and large size rearrangements of BMPR2 were screened for. Clinical, functional, and hemodynamic characteristics, as well as outcomes, were compared in BMPR2 mutation carriers and noncarriers.

Patients

Patients were seen within the French Network of Pulmonary Hypertension between January 1, 2004, and June 1, 2007. In accordance with the guidelines of the American College of Chest Physicians (20), patients with idiopathic and familial PAH tested for BMPR2 mutations underwent genetic counseling and signed written, informed consent. Two hundred and thirty-three consecutive patients (195 idiopathic and 38 familial PAH) were tested for BMPR2 point mutation and large size rearrangements. This corresponded to 68 BMPR2 mutation carriers (40 idiopathic and 28 familial), 155 idiopathic PAH noncarriers, and 10 patients with familial PAH with no evidence of BMPR2 mutation. Patients with familial PAH with no evidence of BMPR2 mutation were excluded from the analysis to decrease the risk of misclassification in the BMPR2 mutation noncarrier group (Figure 1).

A diagnosis of PAH was established by means of right heart catheterization and acute vasodilator challenge was performed through inhalation of nitric oxide or intravenous injection of prostacyclin, according to previously described methods (1, 21, 22). Idiopathic PAH was recognized after ruling out all associated conditions of pulmonary hypertension, summarized in the revised classification, and by determining no existence of additional pulmonary hypertension cases in the family of the patient (2). Familial PAH was recognized if there was more than one confirmed case in the family (2).

All clinical characteristics at PAH diagnosis and follow-up were stored in the Registry of the French Network of Pulmonary Hypertension. This registry was set up in agreement with French bioethics laws (French Commission Nationale de l'Informatique et des Libertés), and all patients gave their informed consent (23). The six-minute-walk distance as well as the percentage of reference values were studied (23, 24). All patients were treated according to international guidelines, which recommend a similar management in familial and idiopathic PAH (25, 26).

Molecular Methods
Screening of point mutations in the coding regions and intronic junctions of BMPR2.

Amplification of all coding exons and intronic junctions of the BMPR2 gene was performed on genomic DNA from each individual using 16 fragments, with primers described in Table 1. Genetic variation of BMPR2 sequence was detected by denaturing high-performance liquid chromatography (dHPLC) using a WAVE Nucleic Acid Fragment Analysis System (Transgenomic, Elancourt, France). The temperature used for successful resolution of heteroduplex molecules was determined by the dHPLC melting algorithm and a control polymerase chain reaction (PCR) product (with a known mutation). Samples with an altered dHPLC profile were sequenced using the BigDye Terminator v1.1 cycle sequencing kit (Applied Biosystems, Foster city, CA) on an ABI 3730 DNA sequencer (Applied Biosystems). The resulting sequences were compared with the reference sequence of BMPR2 gene (accession no. NM_001204) with the ABI SeqScape software, version 2.5 (Applied Biosystems).

TABLE 1. OLIGONUCLEOTIDES FOR POLYMERASE CHAIN REACTION AND SEQUENCING OF THE BMPR2 GENE


Exons

Forward Primer (F)

Reverse Primer (R)

Size(bp)

Annealing (°C)
1TATTGTGATACGGGCAGGATGACGCATGGCGAAGGGCAA29658
2CAGTTCAAATAATTTAGTAGGGCTGAACAGGATTTTAACATAC37958
3ACTGTTTCATAGCTTACACGTATCACGCCTGGCTTCAACC38858
4CAGCCTTTCTAAAGGGCAGTCCTGTCCATACGTGATACTA29952
5CTTGCTGCTAATCTTTCTGCAAATGAATGAATGTCTTAATGAT30052
6TGATAATGGAATAAACTGTAAGGCATAAGCCACCACACCTG39552
7TGCTAATTTACTCTTCATGTTCAAACAACTGACTAATAATAAA31650
8ATTTCATGTTCAATAGTCCCTTGCGTGAGCCACCACACCTG30752
9GGTCTAATGTCTGTTCTTCAAAAGTTGAGTTAGGTACTATA30050
10TATCAGAAATACCCCTGTTACGTTATTAACAGTCTATTTTTG30350
11TTAAAGACACATGGTTTGACATCATTGAACTATAGGCTGG31450
12ACAACTCAGACTTTAAAATCAGGTGGTATGCAGATTTGTTTC43658
12BCAAACACCACAAGGACTCACGAACTAGTAGGTCTCTTGGGA42958
14CATGTTTGATTCCTGATGTTCCCAGCTTGTTGCTCTCGTC44258
15AACATAGTGACACATAGGGCAAAGGTAAATAATCACTAGTTG46558
13
TACATCCCTTACCCGTTATT
CTTCTGCATGTTTAAATGATG
374
58

Screening of BMPR2 large size rearrangements.

The BMPR2 gene was screened for large size rearrangements either using the SALSA multiplex ligation-dependent probe amplification (MLPA) P093 HHT probe mix kit (MRC-Holland BV, Amsterdam, The Netherlands) according to the manufacturer's instructions or by quantitative multiplex PCR of fluorescent short fragments (QMPSF) (27). In the latter case, BMPR2 exons were amplified (size of fragments ranging from 132 to 308 bp) in three multiplex PCRs and the forward primer of each pair was 5′-labeled with the 6-Fam fluorochrome. Fragment analysis of multiplex PCR (from MLPA or QMPSF) was performed on an ABI 3730 DNA analyzer and results were analyzed using GeneMapper software, version 4.0 (Applied Biosystems). Two DNA samples from unaffected individuals were used as controls in each experiment. Electrophoregrams were superimposed on those generated with a control DNA by adjusting to the same levels the peaks obtained for the control amplicons.

Statistical Analysis

We compared demographic and clinical features between BMPR2 mutation carriers and noncarriers with the use of χ2, Fisher's exact test, Mann-Whitney test, or t test, as appropriate. Both the time to death (patients undergoing lung transplantation were considered as censored at the date of transplantation) and the time to death or lung transplantation (patients undergoing lung transplantation were considered as an event at the date of transplantation) were described using Kaplan-Meier curves, and compared with the use of the log-rank test. A P value of less than 0.05 was considered to indicate statistical significance.

Clinical and Functional Characteristics

A BMPR2 mutation was identified in 40 of 195 idiopathic PAH (20.5%) and 28 of 38 familial cases (73.7%). We thus compared 68 idiopathic and familial BMPR2 mutation carriers with 155 idiopathic PAH noncarriers.

Age at diagnosis of PAH was significantly younger in BMPR2 mutation carriers, as compared with noncarriers (34.5 ± 14.5 vs. 46.0 ± 16.1 yr, P < 0.0001; Table 2). No other clinical differences were found between the two subgroups at diagnosis, including a similar female predisposition to PAH, regardless of BMPR2 status (Table 3). Six-minute-walk distance at diagnosis was 351 ± 106 m in BMPR2 mutation carriers versus 328 ± 120 m in noncarriers (P = 0.21). Because patients with BMPR2 mutations were younger, we also expressed the six-minute-walk distance as a percentage of reference values (55 ± 14 in carriers vs. 60 ± 21% of predicted values in noncarriers, P = 0.17).

TABLE 2. CLINICAL CHARACTERISTICS AT DIAGNOSIS OF PULMONARY ARTERIAL HYPERTENSION


BMPR2 Mutation

Noncarriers (n = 155)

Carriers (n = 68)

P
Age, yr46 ± 16.136.5 ± 14.5<0.0001
Sex, female/male2.6/12/10.43
BMI, (kg/m2)24.6 ± 5.724.2 ± 5.50.60
Right heart failure30 (20.5%)15 (23.4%)0.71
Syncope44 (29.7%)20 (32.2%)0.74
NYHA functional class
 I03%0.09
 II16%11%0.49
 III74%69%0.82
 IV10%17%0.19
Six-minute-walk distance, m328 ± 120351 ± 1060.21
Six-minute-walk distance, % of theoretical values
60 ± 21
55 ± 14
0.17

Definition of abbreviations: BMI = body mass index; NYHA = New York Heart Association.

TABLE 3. HEMODYNAMIC CHARACTERISTICS AT DIAGNOSIS OF PULMONARY ARTERIAL HYPERTENSION


BMPR2 Mutation

Noncarriers (n = 155)

Carriers (n = 68)

P
RAP, mm Hg8 ± 58 ± 40.54
, mm Hg56 ± 1364 ± 13<0.0001
PCWP, mm Hg8 ± 37 ± 30.29
CI, L/min/m22.50 ± 0.732.13 ± 0.680.0005
PVR, mm Hg/ L/min/m212.7 ± 6.617.4 ± 6.1<0.0001
SvO2, %63 ± 959 ± 90.02
Acute vasodilator responder*, %
10.3
1.5
0.02

Definition of abbreviations: CI = cardiac index; PAH = pulmonary arterial hypertension; PCWP = pulmonary capillary wedge pressure; = mean pulmonary artery pressure; PVR = pulmonary vascular resistance; RAP = right atrial pressure; SvO2: mixed venous oxygen saturation.

* Acute vasodilator response is defined by a fall in of at least 10 mm Hg, reaching an absolute value of under 40 mm Hg, associated with no change or an increase in CI.

Hemodynamics

As compared with noncarriers, BMPR2 mutation carriers were characterized by a more severe hemodynamic compromise at diagnosis, with a significantly higher mean pulmonary artery pressure () (64 ± 13 vs. 56 ± 13 mm Hg, P < 0.0001), a lower cardiac index (2.13 ± 0.68 vs. 2.50 ± 0.73 L/min/m2, P = 0.0005), a higher pulmonary vascular resistance (17.4 ± 6.1 vs. 12.7 ± 6.6 mm Hg/L/min/m2, P < 0.0001), and a lower mixed venous oxygen saturation (53 ± 9 vs 59 ± 9%, P = 0.02). Mutation carriers were less likely to exhibit a significant response to acute vasodilatory test during right heart catheterization (defined by a fall in of least 10 mm Hg, reaching an absolute value of under 40 mm Hg, associated with no change or an increase in cardiac index) (Table 3) (19, 22, 25, 28).

Medical Management

Due to their more severe hemodynamic baseline presentation, BMPR2 mutation carriers were more likely to receive intravenous prostacyclin as first-line therapy (58 vs. 27%, P = 0.015). In addition, BMPR2 mutation carriers were more likely to undergo lung transplantation when compared with noncarriers (11/68 carriers vs. 8/155 noncarriers, P = 0.007).

Survival

Fifty-five of the 223 patients died (18 BMPR2 mutation carriers and 37 noncarriers), with a similar overall survival in both groups (Figure 2A). BMPR2 mutation carriers were more likely to undergo lung transplantation, with a significantly shorter time to death or lung transplantation when compared with noncarriers (log-rank test, P = 0.044; Figure 2B). In addition, BMPR2 mutation carriers developed the disease and subsequently died younger than noncarriers (age at death was 34.4 ± 15.1 vs. 50.5 ± 17.5 yr, P = 0.003) (Figure 3).

BMPR2 Mutations

Germline BMPR2 mutations were located throughout the BMPR2 gene, affecting regions of the gene encoding for the four main parts of the protein (ligand binding, transmembrane region, kinase domain, and cytoplasmic tail). Five long deletions have been identified in the present series, corresponding to two exon 10 deletions, one large deletion from exons 1 to 4, one deletion of exons 11 to 13, and a deletion of the whole allele (Table 4).

TABLE 4. DETAILS OF BMPR2 MUTATIONS


Patient

Mutation Location

Nucleotide Change

Amino Acid Change
1Exon 1c.48G>Ap.Trp16X
2Exon 1c.48G>Ap.Trp16X
3Exon 2c.197G>Ap.Cys66Tyr
4Exon 2c.200A>Gp.Tyr67Cys
5Exon2c.247G>Ap.Gly83Arg
6Exon 3c.255G>Ap.Trp85X
7Exon 3c.274C>Tp.Gln92X
8Exon 3c.280T>Cp.Cys94Arg
9Exon 3c.320C>Gp.Ser107X
10Exon3c.339C>Ap.Tyr113X
11Exon 3c.350G>Cp.Cys117Ser
12Exon 3c.370A>Gp.Asn124Asp
13Exon 4c.439C>Tp.Arg147X
14Exon 4c.439C>Tp.Arg147X
15Exon 5c.551_573delp.His184fsX191 (p.His184fsX8)
16Exon 5c.604A>Tp.Asn202Tyr
17Exon 5c.583G>Tp.Glu195X
18Exon 6c.612delAp.Lys204fsX208 (p.Lys204fsX4)
19Exon 6c.631C>Tp.Arg211X
20Exon 6c.631C>Tp.Arg211X
21Exon 6c.631C>Tp.Arg211X
22Exon 6c.631C>Tp.Arg211X
23Exon 6c.689_690delp.Lys230fsX254 (p.Lys230fsX25)
24Exon 6c.775delCp.Arg259fsX261 (p.Arg259fsX3)
25Exon 6c.830T>Cp.Leu277Pro
26Exon 7c.901T>Cp.Ser301Pro
27Exon 7c.901T>Cp.Ser301Pro
28Exon 7c.928A>Tp.Arg310X
29Exon 7c.961C>Tp.Arg321X
30Exon 7c.961C>Tp.Arg321X
31Exon 7c.961C>Tp.Arg321X
32Exon 8c.1001T>Gp.Leu334X
33Exon 8c.1019T>Cp.Leu340Pro
34Exon 8c.1099_1103delp.Gly367fsX370 (p.Gly367fsX3)
35Exon 9c.1171G>Ap.Ala391Thr
36Exon 9c.1272insCp.Phe424fsX447 (p.Phe424fsX24)
37Exon 10c.1392delAp.Glu464fsX473 (p.Glu464fsX10)
38Exon 10c.1399delAp.Lys467fsX473 (p.Lys467fsX7)
39Exon 11c.1447T>Cp.Cys483Arg
40Exon11c.1471C>Tp.Arg491Trp
41Exon11c.1471C>Tp.Arg491Trp
42Exon11c.1471C>Tp.Arg491Trp
43Exon11c.1471C>Tp.Arg491Trp
44Exon11c.1471C>Tp.Arg491Trp
45Exon 11c.1472G>Ap.Arg491Gln
46Exon 11c.1472G>Ap.Arg491Gln
47Exon 11c.1472G>Ap.Arg491Gln
48Exon 12c.1771C>Tp.Arg591X
49Exon 12c.2521_2522dupCAp.His841fsX859 (p.His841fsX19)
50Exon 12c.2617C>Tp.Arg873X
51Exon 12c.2617C>Tp.Arg873X
52Exon 12c.2617C>Tp.Arg873X
53Exon 12c.2617C>Tp.Arg873X
54Exon 12c.2617C>Tp.Arg873X
55Exon 12c.2617C>Tp.Arg873X
56Exon 12c.2618G>Ap.Arg873Gln
57Intron 2c.248-1G>ASplice defect
58Intron 3c.418+3A>TSplice defect
59Intron 3c.418+3A>TSplice defect
60Intron 3c.418+3A>TSplice defect
61Intron 6c.853-2A>GSplice defect
62Intron 6c.853-1G>CSplice defect
63Intron 9c.1277-9A>GSplice defect (demonstrated on cDNA)
64Deletion of exon 1 to 4Large rearrangement
65Deletion of exon 10Large rearrangement
66Deletion of exon 10Large rearrangement
67Deletion of exon 11 to 13Large rearrangement
68

Deletion of exon 1 to 13
Large rearrangement

The mutation nomenclature follows current guidelines as recommended by the Human Genome Variation Society (www.hgvs.org/mutnomen/). Protein consequence for frame shift mutation: italic type in accordance with the latest nomenclature: “the position of the stop in the new reading frame is calculated starting at the first amino acid that is changed by the frame shift, and ending at the first stop codon” (40).

We have studied a group of 223 patients with familial and idiopathic PAH with or without germline BMPR2 mutations and treated according to the best standard of care in a national pulmonary hypertension network. Our results indicate that there is a significantly increased severity of hemodynamic status in BMPR2 mutation carriers at diagnosis when compared with noncarriers, as demonstrated by higher , lower cardiac index, higher total pulmonary resistance, and lower mixed oxygen saturation. Although there was no difference in overall survival after diagnosis, BMPR2 mutation carriers had a significantly shorter time to death or lung transplantation, indicating that they were more likely to undergo lung transplantation. Because lung transplantation is the ultimate alternative for severe PAH cases who cannot be managed medically (25), time to death or transplantation is an indicator of disease severity in this patient population (29). In addition, BMPR2 mutation carriers developed the disease earlier with fatal events occurring at a younger age. Therefore, the overall findings plead in favor of a more severe disease state in patients with BMPR2 mutation. In recent registries, including the French registry (23), no difference between familial and idiopathic PAH could be evidenced in terms of severity, presumably because of the substantial proportion of BMPR2 mutation carriers in each group, which in fact biased the comparison. The present comprehensive analysis of well-defined BMPR2 mutation carriers and noncarriers allows avoiding such a bias.

The observation that subjects with BMPR2 mutation develop the disease earlier and with a more severe hemodynamic compromise illustrates the constitutive susceptibility conferred by the mutation on the course of the disease. Although the penetrance of BMPR2 mutation is low, in agreement with data from mice with heterozygous inactivation of BMPR2, which only shows a susceptibility to inflammatory stress or excess serotonin (30, 31), BMPR2 haploinsufficiency determines a pulmonary vascular status that leads to PAH in an accelerated fashion. The younger age of onset is also observed for other diseases where an inherited genetic factor confers a strong predisposition, as in hereditary forms of breast and colon cancer. In these cases, a heterozygous germline mutation in a DNA repair gene or tumor suppressor gene favors a second genetic event, or second hit, which in turn leads to a series of somatic mutations in specific cells and to the development of cancer (32). In the case of BMPR2 mutation, the gene is involved in proliferation of pulmonary artery vascular smooth muscle cells under the control of bone morphogenetic proteins. Indeed, a reduced apoptotic response to bone morphogenetic proteins was shown in pulmonary artery vascular smooth muscle cells from pulmonary hypertensive patients with a BMPR2 mutation, as compared with control cells, suggesting a change in phenotype secondary to genetic events (33, 34). Somatic genetic events were investigated in smooth muscle cells from affected pulmonary arteries, such as DNA microsatellite instability, a hallmark of genome instability, or loss of heterozygosity attesting chromosomal deletion, but negative results do not plead in favor of the hypothesis of a second genetic somatic event (35). Although other kinds of somatic genetic or epigenetic events cannot be eliminated, their nature remains elusive.

Any familial disease may lead to an earlier diagnosis in subsequent similar cases. However, a majority of BMPR2 mutant carriers from the present study displayed idiopathic PAH (40 of 68, 59%). In addition, 5 of 28 familial cases of BMPR2 mutant carriers were the first identified case in these families. Therefore, only 23 BMPR2 mutant carriers (34%) had a familial history of PAH at diagnosis. Thus, heightened suspicion of PAH was present in a minority of BMPR2 mutant carriers. To further analyze this population, we have compared delay between onset of symptoms and diagnosis in patients with or without familial history of PAH. As expected, patients with a history of PAH had a shorter delay between onset of symptoms and diagnosis (1.5 ± 2.3 vs. 0.6 ± 0.6 yr, P = 0.036). This could not explain the differences in disease presentation, such as the more than 10-year age difference at diagnosis and death between BMPR2 mutation carriers and noncarriers. The later onset in noncarriers could imply that, compared with patients with a germline BMPR2 haploinsufficiency, additional events are required for the disease to develop, resulting in a significant older age of onset. The nature of these events is unknown, and they are probably partially similar to those involved in BMPR2 mutation carriers. For example, a down-regulation of the bone morphogenetic protein pathway is observed in both types of smooth muscle cells, either from BMPR2 mutation carriers or noncarriers. In this latter case, the down-regulation origin is unknown (36). The worse hemodynamic parameters at diagnosis in BMPR2 mutation carriers might reflect an accelerated process of the disease, but this is not confirmed by the overall survival. Nevertheless, time to death or lung transplantation was shorter in BMPR2 mutation carriers as compared with noncarriers, further suggesting that BMPR2 mutation confers a more severe phenotype.

The disequilibrium in the female/male ratio was previously reported for familial and idiopathic PAH (5, 23, 37, 38) and many hypotheses have been raised to explain it, including a disadvantage of male embryos carrying a BMPR2 mutation (5). Interestingly, the female/male ratio was identical in BMPR2 mutation carriers and noncarriers, suggesting that this disequilibrium does not result from a meiotic drive or embryonic lethality but more likely from specific sex-dependent factors acting later in life and favoring the occurrence of the disease in females.

We have excluded from the analysis the 10 patients with familial PAH who did not carry BMPR2 mutations. It is possible, however, that these patients carry mutations in some unexplored parts of the BMPR2 gene. As mentioned in Methods, we have performed amplification of all coding exons and intronic junctions of the BMPR2 gene and may thus miss alterations in other intronic regions or other mechanisms, such as epigenetic alterations of this gene that have not been recognized at this time. This possibility has been partly evaluated by Aldred and colleagues who analyzed part of the 5′-untranslated region and promoter of the gene in familial PAH (39). DNA upstream of the coding region was analyzed by direct sequencing in 16 families. In one family, a mutation predicted to form a cryptic translational start site was identified. This mutant transcript contains a premature stop codon (39). These results further emphasize the possibility that current techniques could miss BMPR2 mutations in some patients.

In conclusion, BMPR2 mutation carriers with PAH present approximately 10 years earlier than noncarriers with a more severe hemodynamic compromise at diagnosis. A better understanding of the mechanisms by which BMPR2 mutations define a subclass of patients with more severe disease is critical for improving our knowledge of PAH.

The authors thank Dr. Grégory Raux (Service de Génétique CHU Charles Nicolle ROUEN) for the design of QMPSF primers and Ms. Rebecca Honan for reading the manuscript.

1. Runo JR, Loyd JE. Primary pulmonary hypertension. Lancet 2003;361:1533–1544.
2. Simonneau G, Galie N, Rubin LJ, Langleben D, Seeger W, Domenighetti G, Gibbs S, Lebrec D, Speich R, Beghetti M, et al. Clinical classification of pulmonary arterial hypertension. J Am Coll Cardiol 2004;43:5S–12S.
3. Dresdale DT, Mitchom RJ, Schultz M. Recent studies in primary pulmonary hypertension, including pharmacodynamic observations on pulmonary vascular resistance. Bull N Y Acad Med 1954;30:195–207.
4. Loyd JE, Primm RK, Newman JH. Familial primary pulmonary hypertension: clinical patterns. Am Rev Respir Dis 1984;129:194–197.
5. Loyd JE, Butler MG, Foroud TM, Conneally PM, Philips JA 3rd, Newman JH. Genetic anticipation and abnormal gender ratio at birth in familial primary pulmonary hypertension. Am J Respir Crit Care Med 1995;152:93–97.
6. Lane KB, Machado RD, Pauciulo MW, Thomson JR, Phillips JA 3rd, Loyd JE, Nichols WC, Trembath RC. Heterozygous germline mutations in a TGFβ receptor, BMPR2, are the cause of familial primary pulmonary hypertension. Nat Genet 2000;26:81–84.
7. Deng Z, Morse JH, Slager SL, Cuervo N, Moore KJ, Venetos G, Kalachikov S, Cayanis E, Fischer SG, Barst RJ, et al. Familial primary pulmonary hypertension (gene PPH1) is caused by mutations in the bone morphogenetic protein receptor-II gene. Am J Hum Genet 2000;67:737–744.
8. Newman JH, Wheeler L, Lane KB, Loyd E, Gaddipati R, Phillips JA 3rd, Loyd JE. Mutation in the gene for bone morphogenetic protein receptor II as a cause of primary pulmonary hypertension in a large kindred. N Engl J Med 2001;345:319–324.
9. Cogan JD, Pauciulo MW, Batchman AP, Prince MA, Robbins IM, Hedges LK, Stanton KC, Wheeler LA, Phillips JA 3rd, Loyd JE, et al. High frequency of BMPR2 exonic deletions/duplications in familial pulmonary arterial hypertension. Am J Respir Crit Care Med 2006;174:590–598.
10. Aldred MA, Vijayakrishnan J, James V, Soubrier F, Gomez-Sanchez MA, Martensson G, Galie N, Manes A, Corris P, Simonneau G, et al. BMPR2 gene rearrangements account for a significant proportion of mutations in familial and idiopathic pulmonary arterial hypertension. Hum Mutat 2006;27:212–213.
11. Thomson JR, Machado RD, Pauciulo MW, Morgan NV, Humbert M, Elliott GC, Ward K, Yacoub M, Mikhail G, Rogers P, et al. Sporadic primary pulmonary hypertension is associated with germline mutations of the gene encoding BMPR-II, a receptor member of the TGFβ family. J Med Genet 2000;37:741–745.
12. Humbert M, Deng Z, Simonneau G, Barst RJ, Sitbon O, Wolf M, Cuervo N, Moore KJ, Hodge SE, Knowles JA, et al. BMPR2 germline mutations in pulmonary hypertension associated with fenfluramine derivatives. Eur Respir J 2002;20:518–523.
13. Koehler R, Grunig E, Pauciulo MW, Hoeper MM, Olschewski H, Wilkens H, Halank M, Winkler J, Ewert R, Bremer H, et al. Low frequency of BMPR2 mutations in a German cohort of patients with sporadic idiopathic pulmonary arterial hypertension. J Med Genet 2004;41:e127.
14. Morisaki H, Nakanishi N, Kyotani S, Takashima A, Tomoike H, Morisaki T. BMPR2 mutations found in Japanese patients with familial and sporadic primary pulmonary hypertension. Hum Mutat 2004;23:632.
15. Machado RD, Aldred MA, James V, Harrison RE, Patel B, Schwalbe EC, Gruenig E, Janssen B, Koehler R, Seeger W, et al. Mutations of the TGF-β type II receptor BMPR2 in pulmonary arterial hypertension. Hum Mutat 2006;27:121–132.
16. Sztrymf B, Yaici A, Girerd B, Humbert M. Genes and pulmonary hypertension. Respiration 2007;74:123–132.
17. Machado RD, Pauciulo MW, Thomson JR, Lane KB, Morgan NV, Wheeler L, Phillips JA 3rd, Newman J, Williams D, Galiè N, et al. BMPR2 haploinsufficiency as the inherited molecular mechanism for primary pulmonary hypertension. Am J Hum Genet 2001;68:92–102.
18. Humbert M, Morrell NW, Archer SL, Stenmark KR, MacLean MR, Lang IM, Christman BW, Weir EK, Eickelberg O, Voelkel NF, et al. Cellular and molecular pathobiology of pulmonary arterial hypertension. J Am Coll Cardiol 2004;43:13S–24S.
19. Elliott CG, Glissmeyer EW, Havlena GT, Carlquist J, McKinney JT, Rich S, McGoon MD, Scholand MB, Kim M, Jensen RL, et al. Relationship of BMPR2 mutations to vasoreactivity in pulmonary arterial hypertension. Circulation 2006;113:2509–2515.
20. McGoon M, Gutterman D, Steen V, Barst R, McCrory DC, Fortin TA, Loyd JE. Screening, early detection and diagnosis of pulmonary arterial hypertension: ACCP evidence based clinical practice guidelines. Chest 2004;126:14S–34S.
21. Sitbon O, Humbert M, Jagot JL, Taravella O, Fartoukh M, Parent F, Herve P, Simonneau G. Inhaled nitric oxide as a screening agent for safely identifying responders to oral calcium-channel blockers in primary pulmonary hypertension. Eur Respir J 1998;12:265–270.
22. Sitbon O, Humbert M, Jais X, loos V, Hamid AM, Provencher S, Garcia G, Parent F, Hervé P, Simonneau G. Long-term response to calcium channel blockers in idiopathic pulmonary arterial hypertension. Circulation 2005;111:3105–3111.
23. Humbert M, Sitbon O, Chaouat A, Bertocchi M, Habib G, Gressin V, Yaici A, Weitzenblum E, Cordier JF, Chabot F, et al. Pulmonary arterial hypertension in France: results from a national registry. Am J Respir Crit Care Med 2006;173:1023–1030.
24. Enright PL, Sherrill DL. Reference equations for the six-minute walk in healthy adults. Am J Respir Crit Care Med 1998;158:1384–1387.
25. Humbert M, Sitbon O, Simonneau G. Treatment of pulmonary arterial hypertension. N Engl J Med 2004;351:1425–1436.
26. Galie N, Torbicki A, Barst R, Dartevelle P, Haworth S, Higenbottam T, Olschewski H, Peacock A, Pietra G, Rubin LJ, et al. Guidelines on diagnosis and treatment of pulmonary arterial hypertension. The Task Force on Diagnosis and Treatment of Pulmonary Arterial Hypertension of the European Society of Cardiology. Eur Heart J 2004;25:2243–2278.
27. Tournier I, Paillerets BB, Sobol H, Stoppa-Lyonnet D, Lidereau R, Barrois M, Mazoyer S, Coulet F, Hardouin A, Chompret A, et al. Significant contribution of germline BRCA2 rearrangements in male breast cancer families. Cancer Res 2004;64:8143–8147.
28. Badesch DB, Abman SH, Ahearn GS, Barst RJ, McCrory DC, Simonneau G, McLaughlin VV. Medical therapy for pulmonary arterial hypertension: ACCP evidence based practice guidelines. Chest 2004;126:35S–62S.
29. Montani D, Souza R, Binkert C, Fischli W, Simonneau G, Clozel M, Humbert M. Endothelin-1/endothelin-3 ratio: a potential prognostic factor of pulmonary arterial hypertension. Chest 2007;131:101–108.
30. Yuan JX, Rubin LJ. Pathogenesis of pulmonary arterial hypertension: the need for multiple hits. Circulation 2005;111:534–538.
31. Long L, MacLean MR, Jeffery TK, Morecroft I, Yang X, Rudarakanchana N, Southwood M, James V, Trembath RC, Morrell NW. Serotonin increases susceptibility to pulmonary hypertension in BMPR2-deficient mice. Circ Res 2006;98:818–827.
32. Knudson AG. Cancer genetics. Am J Med Genet 2002;111:96–102.
33. Zhang S, Fantozzi I, Tigno DD, Yi ES, Platoshyn O, Thistlethwaite PA, Kriett JM, Yung G, Rubin LJ, Yuan JX. Bone morphogenetic proteins induce apoptosis in human pulmonary vascular smooth muscle cells. Am J Physiol Lung Cell Mol Physiol 2003;285:L740–L754.
34. Lagna G, Nguyen PH, Ni W, Hata A. BMP-dependent activation of caspase-9 and caspase-9 mediates apoptosis in pulmonary artery smooth muscle cells. Am J Physiol Lung Cell Mol Physiol 2006;291:L1059–L1067.
35. Machado RD, James V, Southwood M, Harrison RE, Atkinson C, Stewart S, Morrell NW, Trembath RC, Aldred MA. Investigation of second genetic hits at the BMPR2 locus as a modulator of disease progression in familial pulmonary arterial hypertension. Circulation 2005;111:607–613.
36. Atkinson C, Stewart S, Upton PD, Machado R, Thomson JR, Trembath RC, Morrell NW. Primary pulmonary hypertension is associated with reduced pulmonary vascular expression of type II bone morphogenetic protein receptor. Circulation 2002;105:1672–1678.
37. Rich S, Dantzker DR, Ayres SM, Bergofsky EH, Brundage BH, Detre KM, Fishman AP, Goldring RM, Groves BM, Koerner SK, et al. Primary pulmonary hypertension: a national prospective study. Ann Intern Med 1987;107:216–223.
38. D'Alonzo GE, Barst RJ, Ayres SM, Bergofsky EH, Brundage BH, Detre KM, Fishman AP, Goldring RM, Groves BM, Kernis JT, et al. Survival in patients with primary pulmonary hypertension: results from a national prospective registry. Ann Intern Med 1991;115:343–349.
39. Aldred MA, Machado RD, James V, Morrell NW, Trembath RC. Characterization of the BMPR2 5′-untranslated region and novel mutation in pulmonary hypertension. Am J Respir Crit Care Med 2007;176:819–824.
40. den Dunnen JT. Nomenclature for the description of sequence variants; discussion [Internet]. 2002 Nov 17 [updated 2008 Feb 20; accessed 2008 Apr 14]. Baltimore, MD: Human Genome Variation Society. Available at: http://www.hgvs.org/mutnomen/disc.html#frameshift
Correspondence and requests for reprints should be addressed to Marc Humbert, M.D., Ph.D., Service de Pneumologie et Réanimation Respiratoire, Hôpital Antoine-Béclère, 157 rue de la Porte de Trivaux, 92140 Clamart, France. E-mail:

Related

No related items
American Journal of Respiratory and Critical Care Medicine
177
12

Click to see any corrections or updates and to confirm this is the authentic version of record