American Journal of Respiratory and Critical Care Medicine

Although innate immunity is crucial to pulmonary host defense and can initiate immune and inflammatory responses independent of adaptive immunity, it remains unstudied in the context of transplant rejection. To investigate the role of innate immunity in the development of allograft rejection, we assessed the impact of two functional polymorphisms in the toll-like receptor 4 (TLR4) associated with endotoxin hyporesponsiveness on the development of acute rejection after human lung transplantation. Patients and donors were screened for the TLR4 Asp299Gly and Thr399Ile polymorphisms by polymerase chain reaction using sequence-specific primers. The rate of acute rejection at 6 months was significantly reduced in recipients, but not in donors, with the Asp299Gly or Thr399Ile alleles as compared with wild type (29 vs. 56%, respectively, p = 0.05). This association was confirmed in Cox proportional hazards and multivariate logistic regression models. Our results suggest activation of innate immunity in lung transplant recipients through TLR4 contributes to the development acute rejection after lung transplantation. Therapies directed at inhibition of innate immune responses mediated by TLR4 may represent a novel and effective means to prevent acute rejection after lung transplantation.

Lung transplantation is a viable therapeutic option in the care of patients with many advanced pulmonary parenchymal or pulmonary vascular diseases and can provide significant improvements in short-term survival and quality of life. Long-term outcomes after transplantation, however, remain disappointing, with only 50% of patients alive 5 or more years after the operation (1). The major cause of late death after lung transplantation is bronchiolitis obliterans syndrome (BOS) (1). BOS is characterized clinically by progressive airflow obstruction and histologically by fibrous obliteration of the small- to medium-sized bronchioles (i.e., obliterative bronchiolitis [OB]), which is thought to represent a manifestation of chronic allograft rejection (2). Acute allograft rejection, defined by the presence of a mononuclear cell infiltrate in the pulmonary allograft, is the most important risk factor for the development of BOS (3).

Although the lung possesses an extensive system of innate immune defenses, the importance of innate immunity has been previously unstudied in the context of acute lung rejection. Innate immunity generally relies upon recognition of microbial surface molecules through toll-like receptors (TLRs) to initiate a series of genetically programmed immune and inflammatory events in the absence of an adaptive response. (4) Endotoxin or LPS, a prototypical trigger of innate immunity found on gram-negative bacteria, interacts with TLR4 to induce production of chemokines and cytokines, recruit and activate monocytes and macrophages, and upregulate costimulatory molecules on antigen presenting cells necessary for appropriate adaptive responses (5). TLR4, expressed on macrophages, dendritic cells, airway epithelia, and many other tissues, is now recognized to interact with a variety of other endogenous and exogenous ligands, including heat shock proteins, respiratory syncytial virus, and hyaluronic acid (6, 7).

We hypothesize that activation of innate immunity through TLRs contributes to the development of acute rejection after lung transplantation. Cardiac surgery, with or without cardiopulmonary bypass, has been shown to increase circulating endotoxin levels. Furthermore, surgical trauma, ischemia–reperfusion injury, or pulmonary infections at the time of transplant are likely to provide exposure to endogenous or exogenous ligands for TLR4 in virtually all lung transplant recipients. Two recently described functional polymorphisms of the TLR4 receptor associated with blunted responsiveness to endotoxin in vitro and in vivo provide an opportunity to critically evaluate the role of innate immunity in acute rejection after lung transplantation (8). We screened DNA from lung transplant recipients and their respective cadaveric donors for heterozygosity for two TLR4 polymorphisms previously associated with endotoxin hyporesponsiveness in order to determine if the rate of acute allograft rejection is decreased in endotoxin-hyporesponsive patients.

Transplant Population

Appropriate institutional review board (IRB) approval was obtained. From October 1, 1998 to April 1, 2002, genomic DNA was isolated from 174 lung transplant recipients and 157 of their cadaveric donors. Analysis of biopsy-proven acute rejection rates at 6 months after transplant was performed in the 147 (85%) patients who survived at least that long after surgery. Patients who died prior to 6 months were not included because, in many cases, death occurred prior to any lung biopsies. Standardized surgical techniques and posttransplant management protocols were employed as described elsewhere (9). Briefly, patients initially received tacrolimus, azathioprine and corticosteroids for immune suppression and a monoclonal interleukin-2 receptor antibody as induction immunosuppression. Surveillance biopsies were done at 1, 3, and 6 months posttransplant, or if clinical indications developed, according to a predefined protocol (e.g., new infiltrate, fever, or greater than 20% decline in FEV1 from posttransplant baseline). Acute rejection was defined and graded according to standard histologic criteria (10). Episodes of acute allograft rejection were treated with methylprednisolone, 500 mg per day for 3 days, followed by an oral prednisone taper. The acute rejection score was calculated by adding the sum of grades of each rejection episode.

Determination of TLR4 Polymorphisms

Genomic DNA was isolated from blood by using the Puregene DNA Isolation Kit (Gentra Systems, Minneapolis, MN). TaqMan assays were used for genotyping the Asp299Gly and Thr399Ile polymorphisms of the human Toll 4 gene (8). Assays were designed using Primer Express software (Applied Biosystems, Foster City, CA). Fluorescent probes were constructed with the minor groove–binding protein and nonfluorescent quencher for added thermostability and lower fluorescent background. Plasmids carrying the polymorphisms (299/399) and wild-type alleles were used as controls for each genotyping assay. Primer and probe concentrations were optimized using these control plasmids (Table 1)

TABLE 1. Oligonucleotide sequences and optimized concentrations for genotyping the ASP299gly and THR399ile polymorphisms of human toll-like receptor 4


Oligonucleotide

Sequence

Concentration (nM)
D299G wild typeTET-CCTCGATGATATTATT-MGBNFQ900
D299G mutantFAM-CCTCGATGGTATTAT-MGBNFQ50
299 forward primerGAAGAATTCCGATTAGCATACTTAGACTACT200
299 reverse primerTAATTCTAAATGTTGCCATCCGAA200
T399I wild typeTET-CTTTAGGCTGGTTGT-MGBNFQ900
T399I mutantFAM-CTTTAGGCTGATTGTC-MGBNFQ50
399 forward primerCAGAAGTTGATCTACCAAGCCTTGA200
399 reverse primer
GTAATAACACCATTGAAGCTCAGATCTAA
200

Definition of abbreviations: FAM = 6-carboxyfluorescein; MGBNFQ = minor groove binder/nonfluorescent quencher; TET = 6-carboxy-4,7,2',7'-tetrachlorofluorescein.

. A different fluorescence label (FAM for mutant and TET for wild type) was used to 5′ label allelic probes, and fluorescence signal of each reporter dye was measured on the ABI 7900 Sequence Detection System (Applied Biosystems, Foster City CA) at the end of 40 cycles of amplification. Thermal cycling was performed on the MJ Tetrad thermal cycler (MJ Research, Waltham, MA), with the following cycling parameters: initial cycles of 50°C for 2 minutes and 95°C for 10 minutes followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute, with a final holding cycle of 4°C. The TLR4 TaqMan assay results were performed at least in duplicate, with 100% reproducibility of results, and further validated with direct DNA sequencing of selected samples.

Statistical Analysis

Patient demographic characteristics are reported using descriptive statistics. A power calculation was performed a priori, and demonstrated that a sample size of at least 120 donors and 120 recipients would provide a power of 80% to detect a 25% absolute reduction in the rate of acute rejection from a baseline rate of at least 50% (with a two-tailed α = 0.05). Comparison of rejection rates at 6 months were analyzed by Fisher's exact test, time to first acute rejection was analyzed with Cox proportional hazards method, and the odds ratio for no acute rejection at 6 months after transplant was calculated using a multivariable logistic regression model (using SAS software version 8.2; SAS Institute, Cary, NC).

Frequency of Acute Rejection and Gene Polymorphisms

Over the first 6 months after transplant, biopsy-proven acute allograft rejection developed in 79 of 147 (54%) lung transplant recipients. Heterozygosity for the Asp299Gly and/or Thr399Ile polymorphisms occurred in 16% of the donors and 10% of the recipients; the remainder of patients in each group was wild type and no homozygotes for either polymorphism were identified. Six donors had Asp299Gly alone, one donor had Thr399Ile alone, and all others had both cosegregating polymorphisms. Two recipients had Thr399Ile alone, whereas all other recipients had both polymorphisms.

Demographic Characteristics of Recipients

The demographic characteristics of the study population of lung transplant recipients with and without the Asp299Gly or Thr399Ile polymorphisms are included and compared in Table 2

TABLE 2. Characteristics of lung transplant recipients with or without human toll-like receptor 4 polymorphisms



299/399 TLR4*

Wild Type TLR4
Characteristic
(n = 14)
(n = 133)
Native Disease, n (%)
Empysema/α-1-antitrypsin deficiency8 (58)65 (49)
Cystic fibrosis/bronchiectasis2 (14)30 (22)
Idiopathic pulmonary fibrosis2 (14)25 (19)
Sarcoid1 (7)5 (4)
Pulmonary hypertension1 (7)3 (2)
Others0 (0)5 (4)
Recipient age, mean ± SD52 ± 1349 ± 14
Donor age, mean ± SD30 ± 1832 ± 16
Sex, n (%)
Males7 (50)74 (57)
Females7 (50)59 (43)
Race, n (%)
White13 (93)118 (89)
African American1 (7)15 (11)
Type of transplant operation, n (%)
Single3 (21)28 (21)
Bilateral11 (79)105 (79)
Mean no. HLA mismatches4.64.6
PRA > 10%
1 (7)
3 (2)

*Asp299Gly or Thr399Ile or Both.

Definition of abbreviations: PRA = panel reactive antibody; TLR = toll-like receptor.

. The most common indications for transplant in both groups were chronic obstructive pulmonary disease, cystic fibrosis, and idiopathic pulmonary fibrosis. The populations were similar in the number of males and females, donor and recipient ages, and race. Patients in both groups underwent more bilateral transplant operations than single lung operations, consistent with our program's bias toward bilateral transplant whenever possible. The immunologic risk to both groups, as reflected in the degree of HLA mismatch or the number of patients with elevated panel reactive antibody (PRA), was similar.

Impact of 299/399 TLR4 Polymorphisms in Donors upon Acute Rejection Rates

There was no significant difference in the rate of acute allograft rejection (biopsy-proven rejection grade 1 or higher) at 6 months after transplant between recipients who received transplants from cadaveric donors with or without the TLR4 mutations (57% rate of rejection in TLR4 mutants versus 56% rate of rejection in wild type donors; p = 0.93). There was also no significant difference in the time to first acute rejection in recipients who received transplants from either wild-type or mutant cadaveric donors (p = 0.88 by log–rank test), as shown in Figure 1

. A similar number of biopsies was performed among recipients of wild-type and mutant cadaveric donors (mean of 3.3 biopsies per patient in each group; p = 0.85). A similar severity of acute rejection was observed in recipients of wild-type and mutant cadaveric donors (mean acute rejection score per patient 1.2 in each group; p = 0.82).

Impact of 299/399 TLR4 Polymorphisms in Recipients upon Acute Rejection Rates

There was a significant reduction in the rate of acute allograft rejection (biopsy-proven rejection grade 1 or higher) at 6 months after transplant in recipients with the TLR4 polymorphisms as compared with wild-type (29% rate of rejection in TLR4 mutants versus 56% rate of rejection in wild-type recipients; p = 0.05). This reflects a reduction in both grade 1 and grade 2 or 3 rejection between the two groups as shown in Table 3

TABLE 3. Rates of rejection by grade in lung transplant recipients


Grade

299/399 Polymorphism (%)

Wild-Type (%)
I017
II, III2939
Total
29
56*

*p Value = 0.05 by Fisher's exact test.

. There was also a trend toward a significant delay in the time to first acute rejection in TLR4 polymorphic recipients as compared with wild-type (p = 0.07 by log–rank test), as shown in Figure 2 . A similar number of biopsies was performed among wild-type and polymorphic recipients (mean of 3.2 biopsies per patient in each group; p = 0.88). A slight nonsignificant reduction in the severity of acute rejection was observed in mutant recipients as compared with wild-type recipients (mean acute rejection score per patient 0.9 mutants versus 1.2 wild-type; p = 0.44). A multivariate model was performed in those patients in whom complete demographic information on the donors and recipients was available (n = 126). Factors considered in the model included recipient age, donor age, recipient sex, type of transplant operation, race, number of HLA mismatches, and PRA percent. Only heterozygosity for either polymorphism was significantly predictive of having no acute rejection at 6 months (p = 0.02; odds ratio = 4.66; 95% confidence interval = 1.6–17.9).

Acute rejection is a major barrier to successful outcomes after lung transplantation. Even a single episode of minimal grade 1 rejection early after transplant increases the likelihood for BOS, the leading cause of late death after lung transplant, by over 10% (11). In this study, our results indicate that the polymorphisms in TLR4 that downregulate the response to endotoxin are associated with a significant reduction in the rate of acute allograft rejection and thus demonstrate a novel role for innate immunity in the pathobiology of acute rejection after lung transplantation.

Our findings suggest a crucial role for mediator release by recipient leukocytes but not donor tissues (e.g., bronchial epithelium) in the acute rejection response to human lung allotransplantation. Our results are consistent with the observations that donor antigen-presenting cells are quickly replaced by recipient alveolar macrophages, which are observed in transplanted lungs as early as 2 weeks after the operation (12). This finding is also consistent with the known high levels of expression of TLR4 on macrophages, dendritic cells, and B-cells (6). Innate activation of recipient antigen-presenting cells may influence the development of acute rejection through induction of crucial costimulatory molecules, such as B7–1 (CD80) or B7–2(CD86). Indirect activation of naive T cells requires the presence of appropriate costimulatory signals (e.g., CD28 on T cells binds to B-7) for an adaptive response. In addition, innate activation can stimulate production of a variety of inflammatory cytokines and chemokines by recipient leukocytes that recruit and activate T-lymphocytes to the allograft (6). Our group has previously shown that patients with the Asp299Gly and Thr399Ile polymorphisms have reduced circulating proinflammatory cytokines, acute phase reactants, and soluble adhesion molecules (13). Thus, activation of TLR4 in recipient leukocytes will strongly influence the posttransplant inflammatory milieu and subsequent rejection response.

In interpreting our findings, an important limitation must be considered. Our work represents a single-center observational study. Additional multicenter studies with a larger number of patients would be useful to confirm the importance of these polymorphisms on the development of acute rejection. Our results, however, are unlikely to be significantly altered with the inclusion of additional patients for several reasons. First, our sample size is appropriately powered based upon the rates of acute rejection observed in this population. Second, the reduction in acute rejection in recipients with the polymorphism was seen consistently across several different statistical analyses, including a multivariate model that controlled for baseline demographic and immunologic variables. We also recognize, as another study limitation, that our current analysis did not address rates of infection complications. We plan a future analysis that includes much longer follow-up time to address this concern in detail. Because all our lung transplant recipients receive prophylactic antimicrobial therapy for several weeks to months after transplantation, we do not expect to see significant differences in rates of infection between the two groups during the early time period of the current study.

Because of the relatively small number of patients with the 299 or 399 polymorphism who experienced any rejection at all, it is difficult to determine if the polymorphism has a significant impact upon the severity of rejection. Certainly, the presence of rejection among a few 299/399 heterozygotes suggests that adaptive immune responses to the allograft can occur independently of innate immune activation. Alternatively, innate immune activation may contribute to allograft rejection in those patients but through mechanisms other than TLR4 (such as activation of other TLRs, including TLR2 or TLR9).

The high rates of acute rejection in lung transplantation and the lack of effect of HLA matching to predict the development of rejection after transplant suggests that genetic risks for pulmonary allograft rejection are multifactorial and much more complex than previously thought (14). Cytokine gene and chemokine gene polymorphisms appear to influence the development of acute or chronic rejection in some organ systems (1518). Effects of specific polymorphisms, however, have been inconsistent across different studies and particularly among different organs (19). Such studies are often limited by small sample sizes, low rates of acute rejection, and analysis of polymorphisms of unclear functional significance. Our results open another avenue of research that includes further study of functional polymorphisms involved in recipient innate immune activation (e.g., LPS binding protein, CD14, and other TLRs). This area of research represents a promising target for future studies designed to elucidate the genetic risks for acute rejection.

Our identification of a novel role of innate immunity in lung transplant rejection has important implications for screening and management of this transplant population. TLR4 genotyping prior to transplant permits assessment of the risks for acute rejection after transplantation and thus may allow for individualization of the posttransplant immunosuppressive regimens. A reduction of immunosuppression in patients with TLR4 heterozygosity may be possible and desirable because of the many toxic effects of most immunosuppressive medications. Furthermore, currently employed immunosuppressive agents, such as cyclosporine, have potent effects on T cell activation and interleukin-2 production, but appear to have only minimal effects upon endotoxin-induced inflammatory cytokine production by human alveolar macrophages (20). Therefore, our results imply that alternative therapies directed at prevention of innate immune activation though TLR4 may be effective in the prevention or treatment of acute allograft rejection.

In conclusion, our results demonstrate a significant association between polymorphisms in TLR4 that downregulate the response to endotoxin and reduced early acute allograft rejection. Almost every study that has examined the development of long-term allograft dysfunction manifested as BOS has identified acute rejection as the single most important risk factor (3). The reduction in early acute rejection in TLR4 heterozygotes, therefore, would be expected to result in a decreased rate of BOS and improved long-term patient quality of life and survival. Our data provide support for the novel hypothesis that innate immune mechanisms contribute to the development of acute rejection after lung transplantation and, thus, may lead to a substantial shift in the current mechanistic and treatment paradigms for allograft rejection after lung transplantation.

1. Hosenpud JD, Bennett LE, Keck BM, Boucek MM, Novick RJ. The registry of the International Society for Heart and Lung Transplantation: seventeenth official report-2000. J Heart Lung Transplant 2000;19:909–931.
2. Heng D, Sharples LD, McNeil K, Stewart S, Wreghitt T, Wallwork J. Bronchiolitis obliterans syndrome: incidence, natural history, prognosis, and risk factors. J Heart Lung Transplant 1998;17:1255–1263.
3. Sharples LD, McNeil K, Stewart S, Wallwork J. Risk factors for bron-chiolitis obliterans: a systematic review of recent publications. J Heart Lung Transplant 2002;21:271–281.
4. Kimbrell DA, Beutler B. The evolution and genetics of innate immunity. Nat Rev Genet 2001;2:256–267.
5. Xu Y, Tao X, Shen B, Horng T, Medzhitov R, Manley JL, Tong L. Structural basis for signal transduction by the Toll/interleukin-1 receptor domains. Nature 2000;408:111–115.
6. Schuster JM, Nelson PS. Toll receptors: an expanding role in our understanding of human disease. J Leukoc Biol 2000;67:767–773.
7. Kurt-Jones EA, Popova L, Kwinn L, Haynes LM, Jones LP, Tripp RA, Walsh EE, Freeman MW, Golenbock DT, Anderson LJ, et al. Pattern recognition receptors TLR4 and CD14 mediate response to respiratory syncytial virus. Nat Immunol 2000;1:398–401.
8. Arbour NC, Lorenz E, Schutte BC, Zabner J, Kline JN, Jones M, Frees K, Watt JL, Schwartz DA. TLR4 mutations are associated with endotoxin hyporesponsiveness in humans. Nat Genet 2000;25:187–191.
9. Lau CL, Palmer SM, D'Amico TA, Tapson VF, Davis RD. Lung transplantation at Duke University Medical Center. Clin Transpl 1998;14:327–340.
10. Yousem SA, Berry GJ, Cagle PT, Chamberlain D, Husain AN, Hruban RH, Marchevsky A, Ohori NP, Ritter J, Stewart S, et al. Revision of the 1990 working formulation for the classification of pulmonary allograft rejection: Lung Rejection Study Group. J Heart Lung Transplant 1996;15:1–15.
11. Hadjiliadis D, Davis RD, Palmer SM. Is transplant operation important in determining posttransplant risk of bronchiolitis obliterans syndrome in lung transplant recipients? Chest 2002;122:1168–1175.
12. Kjellstrom C, Ichimura K, Chen XJ, Riise GC, Collins VP. The origin of alveolar macrophages in the transplanted lung: a longitudinal microsatellite-based study of donor and recipient DNA. Transplantation 2000;69:1984–1986.
13. Kiechl S, Lorenz E, Reindl M, Wiedermann CJ, Oberhollenzer F, Bonora E, Willeit J, Schwartz DA. Toll-like receptor 4 polymorphisms and atherogenesis. N Engl J Med 2002;347:185–192.
14. Quantz MA, Bennett LE, Meyer DM, Novick RJ. Does human leukocyte antigen matching influence the outcome of lung transplantation? An analysis of 3,549 lung transplantations. J Heart Lung Transplant 2000;19:473–479.
15. Arkwright PD, Laurie S, Super M, Pravica V, Schwarz MJ, Webb AK, Hutchinson IV. TGF-beta(1) genotype and accelerated decline in lung function of patients with cystic fibrosis. Thorax 2000;55:459–462.
16. Asderakis A, Sankaran D, Dyer P, Johnson RW, Pravica V, Sinnott PJ, Roberts I, Hutchinson IV. Association of polymorphisms in the human interferon-gamma and interleukin-10 gene with acute and chronic kidney transplant outcome: the cytokine effect on transplantation. Transplantation 2001;71:674–677.
17. Bathgate AJ, Pravica V, Perrey C, Therapondos G, Plevris JN, Hayes PC, Hutchinson IV. The effect of polymorphisms in tumor necrosis factor-alpha, interleukin-10, and transforming growth factor-beta1 genes in acute hepatic allograft rejection. Transplantation 2000;69:1514–1517.
18. Hutchinson IV, Turner D, Sankaran D, Awad M, Pravica V, Sinnott P. Cytokine genotypes in allograft rejection: guidelines for immunosuppression. Transplant Proc 1998;30:3991–3992.
19. Marshall SE, McLaren AJ, Haldar NA, Bunce M, Morris PJ, Welsh KI. The impact of recipient cytokine genotype on acute rejection after renal transplantation. Transplantation 2000;70:1485–1491.
20. Losa Garcia JE, Mateos Rodriguez F, Jimenez Lopez A, Garcia Salgado MJ, Martin de Cabo MR, Perez Losada J, Perez Arellano JL. Effect of cyclosporin A on inflammatory cytokine production by human alveolar macrophages. Respir Med 1998;92:722–728.
Correspondence and requests for reprints should be addressed to Scott M. Palmer, M.D., M.H.S., DUMC 3876, Room 128, Bell Building, Duke University Medical Center, Durham, NC 27710. E-mail:

Related

No related items
American Journal of Respiratory and Critical Care Medicine
168
6

Click to see any corrections or updates and to confirm this is the authentic version of record