Abstract
The cysteinyl leukotrienes (CysLTs) are important mediators of human asthma. Pharmacologic and clinical studies show that the CysLTs exert most of their bronchoconstrictive and proinflammatory effects through activation of a putative, 7-transmembrane domain, G-protein–coupled receptor, the CysLT1 receptor. The initial molecular characterization of the CysLT1 receptor showed by in situ hybridization, the presence of CysLT1 receptor messenger RNA (mRNA) in human lung smooth-muscle cells and lung macrophages. We confirmed the results of these in situ hybridization analyses for the CysLT1 receptor, and produced the first immunohistochemical characterization of the CysLT1 receptor protein in human lung. The identification of the CysLT1 receptor in the lung is consistent with the antibronchoconstrictive and antiinflammatory actions of CysLT1 receptor antagonists. We also report the expression of CysLT1 receptor mRNA and protein in most peripheral blood eosinophils and pregranulocytic CD34+ cells, and in subsets of monocytes and B lymphocytes.
The cysteinyl leukotrienes (CysLTs), leukotriene (LT)C4, LTD4, and LTE4, are produced by LTC4 synthase from the precursor leukotriene LTA4, which is in turn a product of 5-lipoxygenation of the polyunsaturated fatty acid arachidonic acid (1, 2). LTC4 synthase has been shown to be produced by inflammatory cells, and particularly by eosinophils, and the gene for this enzyme is encoded on chromosome 5q13, a locus rich in genes encoding proinflammatory cytokines such as interleukin (IL)-4, IL-5, and IL-13 (3). CysLTs are the most potent bronchoconstrictors known and have been identified in urine and tissues from patients with a number of respiratory diseases, such as asthma, virus-induced wheezing, and bronchial hyperreactivity (4-7). At least two human CysLT receptors have been defined pharmacologically (8). Most of the biologic activities ascribed to CysLTs, including bronchospasm, plasma exudation, vasoconstriction, mucus secretion, and eosinophil recruitment, are mediated through interaction with the CysLT1 receptor subtype (9). The CysLT1 receptor is also the target of the antiasthmatic CysLT1 receptor antagonists montelukast (Singulair; Merck & Co., West Point, PA) (10-14), zafirlukast (Accolate; Zeneca Pharmaceuticals, Wilmington, DE) (15), and pranlukast (Onon; SmithKline Beecham, Harlow, UK) (16).
The complementary DNA (cDNA) for the CysLT1 receptor has been recently cloned, and encodes a 337-amino acid, G-protein–coupled receptor (GPCR) putatively spanning the 7-transmembrane domain (17, 18). The major intracellular signaling pathway for activation of the recombinant CysLT1 receptor is via calcium release (17, 18). A second CysLT receptor, CysLT2, has been described pharmacologically and appears to be implicated in some of the vascular effects of CysLTs (19). In the human monocytic THP-1 cell, there are at least two signaling pathways activated by CysLTs, which respectively lead to an increase in intracellular calcium that results in activation of mitogen-activated kinase (MAP kinase), and a pertussis toxin-sensitive chemotactic response pathway (20).
The molecular cloning of the CysLT1 receptor has allowed investigation of the expression of this target for asthma therapy. In Northern blot analyses of human tissues, the highest level of expression of the CysLT1 receptor was found in peripheral blood leukocytes, followed by spleen, lung, pancreas, small intestine, and a number of other tissues (17, 18). Reverse transcription–polymerase chain reaction (RT–PCR) has revealed the mRNA for the receptor in a number of cell lines, including THP-1 cells and the human lymphoblastic U937 cell line (K. R. Lynch, personal communication). RT–PCR showed no difference in overall lung expression of the receptor mRNA between normal and asthmatic individuals (18). However, since the in situ pattern of the CysLT1 receptor in human lung showed very confined localization to smooth-muscle cells and some macrophages, detailed in situ hybridization and immunohistochemical comparisons of diseased and normal samples will be needed to address pathologic variation in the expression of the CysLT1 receptor. To date, there have been no descriptions of the CysLT1 receptor protein in any tissues or cells. We describe here the distribution of the CysLT1 receptor protein in smooth-muscle cells of normal human lung and in macrophages and peripheral blood leukocytes.
Recombinant CysLT1 receptor was expressed in Escherichia coli as a lambda repressor CysLT1 receptor–histidine-tagged fusion protein (R. Breyer, Vanderbilt University, U.S. Patent #09/293179), and the purified antigen was used to raise the goat anti-CysLT1 receptor-specific antisera described in these studies. A goat was injected with 0.5 mg of purified recombinant CysLT1 receptor fusion protein in complete Freund's adjuvant, and received three subsequent booster doses of 0.25 mg of the same antigen in incomplete Freund's adjuvant. The antiserum so obtained was titrated with an enzyme-linked immunosorbent assay (ELISA) against the purified recombinant CysLT1 receptor, and was shown to specifically recognize the receptor protein at a dilution of ∼ 1:1,000. For immunoblot analyses, purified recombinant CysLT1 receptor (8 to 160 ng) was separated by sodium dodecylsulfate–polyacrylamide gel electrophoresis on 4%- to 20%–gradient Novex gels and blotted onto nitrocellulose overnight at 100 mA. Blots were blocked for 1 h in 5% milk in Tris-buffered saline containing 0.1% Tween (pH 7.4) (TTBS). Blots were incubated with immune antisera at a 1:5,000 dilution in 5% milk/TTBS for 60 min, washed three times in TTBS, and incubated with a sheep anti goat second antibody (Amersham, Arlington Heights, IL) at a 1:3,000 dilution in 3% milk/TTBS for 60 min. Blots were washed three times in Tris-buffered saline containing 0.3% Tween-20, rinsed with TBS, and subjected to enhanced chemiluminescence (ECL) detection (Amersham) according to the manufacturer's instructions.
Standard blood-cell purification methods were used to obtain partially purified preparations from normal donors. Peripheral blood mononuclear cells (PBMC) were isolated from buffy-coat preparations by centrifugation over lymphocyte separation medium (LSM) (ICN). T cells were rosetted by the incubation of PBMC with neuraminidase-treated sheep red blood cells (SRBC) and were pelleted through LSM. The SRBC were removed by lysis with ammonium chloride potassium (ACK) lysis buffer (Gibco/BRL, Rockville, MD). T-cell–depleted PBMC accumulated at the interface of the LSM. Eosinophils were prepared from peripheral blood from donors known to have increased peripheral blood eosinophils counts as a result of seasonal allergies, but with no history of asthmatic disease. Erythrocytes were removed by hypotonic lysis of the pelleted cells, followed by negative selection with anti-CD16 microbeads (Miltenyi Biotech, Auburn, CA) according to the manufacturer's instructions. Purity of eosinophil preparations was > 90%, with some contaminating monocytes and neutrophils. All preparations of cells were either pelleted in 4% paraformaldehyde or were fresh frozen before in situ hybridization or immunohistochemistry.
Purified blood cells were prepared for histologic analysis by one of the following two methods: (1) fresh-frozen cells were rinsed in phosphate-buffered saline (PBS) (Sigma, St. Louis, MO), made with diethylpyrocarbonate-treated water (Eppendorf, Westbury, NY), resuspended in ornithine carbamyltransferase (OCT) solution (Miles, Elkhart, IN), and frozen at −20° C; or (2) cells were pelleted and fixed in 4% paraformaldehyde (Electron Microscopy Sciences, Fort Washington, PA), dehydrated in graded ethanols, and processed to paraffin. Frozen normal lung biopsy samples (National Disease Research Interchange, Philadelphia, PA) or frozen purified cells were embedded in OCT solution, sectioned at 8 μm, thaw-mounted onto Superfrost Plus slides (Fisher Scientific, Pittsburgh, PA) and fixed for 30 min in 4% paraformaldehyde. Cells embedded in paraffin were dewaxed, rehydrated, and digested for 10 min in 10 μg/ml proteinase K (Boehringer Mannheim, Indianapolis, IN) at room temperature. Oligonucleotide antisense and sense CysLT1 receptor mRNA probes were prepared, and in situ hybridization was done as previously described (17). Bound probe was detected with the TSA direct red fluorescence in situ hybridization tyramide amplification kit (NEN Life Sciences, Boston, MA) according to the manufacturer's instructions. Double-label cell identification immunohistochemistry was performed on specimens that showed a fluorescence signal for CysLT1 receptor mRNA. Cells were rinsed in PBS, blocked with 10% normal donkey serum (Jackson Immunoresearch, West Grove, PA), and incubated for 2 h with the appropriate cell-surface identification marker according to the manufacturer's recommended procedures. Identification marker antisera used on PBMC preparations were CD19 (Pharmingen, San Diego, CA), a marker for B-precursor and B cells; CD18 (Pharmingen), a marker for monocytes and granulocytes; CD34 (Pharmingen), a marker for pluripotent hematopoietic stem cells; LN5 (Zymed, San Francisco, CA), a macrophage marker; CD14 (Serotec, Oxford, UK), a marker for monocytes, granulocytes, and dendritic cells; and an antiserum to the IL-5 receptor β-subunit (R&D Systems, Inc., Minneapolis, MN).
Identification-marker antisera used on T cells were CD4 (Dako, Carpinteria, CA) and CD8 (Dako). The identification marker for eosinophils was the CCR3 receptor, detected with an antiserum from Bruce Daugherty (Merck Research Labs) (21). In the last-named case, immunohistochemistry was done on saponin-treated cells with extensive blocking. Immune-specific signal was detected with the appropriate fluorescein isothiocyanate-labeled donkey secondary antisera (Jackson Immunoresearch). Immune-complexed sections were rinsed and counterstained with DAPI (Molecular Probes, Eugene, OR). Images were acquired, processed, and quantified with a Nikon E1000 microscope (Nikon, Tokyo, Japan), Micromax CCD camera (Princeton Instruments, San Diego, CA), and Metamorph imaging program (Universal Imaging, West Chester, PA).
In order to investigate the distribution of CysLT1 receptor mRNA and protein in human lung and peripheral blood cells, we made a specific oligonucleotide probe, 5′–GAACATAATAGACCACACGGAGAGGCAGTG–3′ (antisense) and antiserum (17). The oligonucleotide antisense probe had previously been shown to recognize CysLT1 receptor mRNA in human lung muscle cells and macrophages (17). The antiserum, first described in the present study, showed specific recognition of the purified CysLT1 receptor on immunoblot analysis (Figure 1A). We were unable to detect the receptor in immunoblot analyses of lung tissue or COS cells transfected with the CysLT1 receptor membrane fractions (data not shown). We calculated from the expression levels of the CysLT1 receptor in human lung or in COS CysLT1 receptor-transfected membranes (both having about 50 fmol/mg protein), and from the sensitivity of the antiserum to recombinant receptor protein, that unless the receptor was concentrated in some fashion, its concentration would be below the detection limits of Western blot analysis. The monomeric recombinant CysLT1 receptor had a molecular weight of approximately 42 kD, but much larger amounts of dimerized and oligomerized receptors were observed in these preparations even in the presence of the denaturing gel detergents (Figure 1A). No CysLT1 receptor signal was seen with antiserum adsorbed with 10 μg/ml purified CysLT1 recombinant receptor or with control, nonimmune goat antisera (Figures 1B and 1C).
Fig. 1. Immunoblot and immunohistochemical analysis of CysLT1 receptor protein. (A) Recognition by CysLT1 receptor antisera (1:5,000) of CysLT1 receptor recombinant protein. (B) CysLT1 receptor antisera (1:5,000) preincubated with 10 μg/ml CysLT1 receptor recombinant protein. (C) Preimmune control goat antisera (1:5,000). Immunoblot analyses were performed as described in Methods. Lanes 1, 2, and 3 contain 160 ng, 32 ng, and 8 ng of CysLT1 receptor recombinant protein, respectively. Molecular weight markers are shown on the left. (D through G) Immunohistochemistry with CysLT1 receptor antisera (1:1,000) of (D) COS cells, (E) COS cells transfected with CysLT1 receptor, (F) COS cells transfected with CysLT1 receptor and treated with CysLT1 receptor antisera (1:1,000) preadsorbed with 10 μg/ml CysLT1 receptor recombinant protein, and (G) COS cells transfected with CysLT1 receptor and treated with normal goat antisera (1:1,000).
[More] [Minimize]Since immunohistochemistry is more sensitive than immunoblot analysis, we conducted immunostaining on COS cells transiently transfected with the CysLT1 receptor and with COS cells alone, and compared the results (Figures 1D through 1G). COS cells alone showed no signal with the antisera (Figure 1D), in contrast to the positive staining observed in CysLT1 receptor-transfected COS cells (Figure 1E). No signal was seen in the same sample with normal goat serum (Figure 1G), and the positive staining for CysLT1 receptor on COS CysLT1-transfected cells was eliminated by preadsorption with recombinant CysLT1 receptor protein (Figure 1F).
In normal human lung, CysLT1 receptor mRNA was expressed in smooth-muscle fibers (Figures 2A and 2B), in accord with our previously reported findings (17). Using the specific CysLT1 antiserum, we found that CysLT1 receptor protein coincided with expression of the receptor mRNA (Figure 2C). The specificity of the immunohistochemical identification of the CysLT1 receptor protein was shown by the absence of signal after preincubation of the antiserum with recombinant CysLT1 protein (Figure 2D). In addition, CysLT1 receptor mRNA and protein were identified in human lung interstitial macrophages by colocalization with LN5 panmacrophage antigen (Figures 2E through 2I). At higher magnification, the CysLT1 receptor protein signal appeared to be punctated (Figures 2H and 2I). The intimate spatial relationship of a lung macrophage and a smooth-muscle cell, both expressing the CysLT1 receptor, is shown in Figures 2H and 2I.
Fig. 2. Expression of CysLT1 receptor mRNA and protein in normal human lung. (A and B) In situ hybridization for CysLT1 receptor. (A) Antisense probe (Texas Red fluorescence), showing CysLT1 receptor expression in bronchial smooth muscle. Cellular nuclei are seen as teal color from DAPI. (B) Sense control probe. (C through E) Immunohistochemistry for CysLT1 receptor. (C ) CysLT1 receptor immunoreactivity (green fluorescence from fluorescein isothiocyanate [FITC]). Cellular nuclei are stained with red fluorescent propidium iodide; (D) CysLT1 receptor antiserum preadsorbed with CysLT1 receptor recombinant protein (red propidium iodide-labeled nuclei); (E ) CysLT1 receptor and LN5 immunoreactivity. Cellular nuclei are seen as blue color from DAPI. (F ) LN5 pan macrophage immunoreactivity (green fluorescence from FITC) of interstitial macrophages in lung section shown in E. (G) CysLT1 receptor immunoreactivity (Texas Red fluorescence), LN5 pan macrophage immunoreactvity (green fluorescence from FITC) and combined CysLT1 receptor and LN5 immunoreactivity, seen as yellow/lime. (H ) Magnified section from G, showing combined CysLT1 receptor and LN5 immunoreactivity in lung macrophage (yellow/lime), CysLT1 receptor immunoreactivity (Texas Red fluorescence) in smooth muscle cell, and nuclei (blue color from DAPI). (I ) Nomarski image of the section shown in H. Scale bars: A, B, C, D, E, F, G = 15 μm; H and I = 5 μm.
[More] [Minimize]Because CysLTs were observed in lung macrophages, and have been suggested to contribute significantly to the inflammatory components of asthma (22), we investigated the expression of the CysLT1 receptor in human peripheral blood cells. In PBMC from which T cells had been removed, we observed CysLT1 receptor mRNA and protein in about 20% of the total cell population (Figures 3A through 3D; Table 1). Subsets of CysLT1-positive PBMC coexpressed CD14 (Figures 4A through 4C) and CD19 (Figures 4D through 4F). These antigenic markers have been used previously to identify monocytic and B-lymphocytic cells, respectively (23, 24). In the PBMC population, immunoreactive labeling of the CysLT1 receptor appeared in clusters (Figures 3C and 4A). The punctate appearance of the CysLT1 receptor protein in peripheral blood cells may reflect oligomerization of the receptor and/or membrane compartmentalization with other proteins or lipids, as has been shown for the chemotactic formyl–met–leu–phe receptor (25). In the PBMC preparation, all of the rarely found pregranulocytic CD34+-staining cells (< 1 per 1,000 cells) (25) coexpressed the CysLT1 receptor (Figures 4G through 4I). The CysLT1 receptor was also found to be coexpressed with some, but not all, cells expressing the IL-5 receptor β-subunit (Figures 4J through 4L).
Fig. 3. Expression of CysLT1 receptor in human peripheral blood monocytes (PBMC). (A and B) In situ hybridization for CysLT1 receptor, (A) Antisense probe (Texas Red fluorescence), nuclei are of blue/purple color from DAPI; (B) sense control probe. (C and D) CysLT1 receptor immunohistochemistry. (C ) CysLT1 receptor immunoreactivity (Texas Red fluorescence). Cellular nuclei stained with DAPI are seen as blue/purple fluorescence. Multilobed polymorphonuclear leukocytes, not expressing the CysLT1 receptor, are marked by arrows; (D) CysLT1 receptor antiserum preadsorbed with CysLT1 receptor recombinant protein eliminates staining. Scale bars: A and B = 15 μm; C and D = 5 μm.
[More] [Minimize]| Population | mRNA (%) | Protein (%) | Cell Identification Markers | |||
|---|---|---|---|---|---|---|
| PBMC | 22 | 24 | CD19, CD34, CD14 | |||
| PBMC (T-cell–depleted) | 40 | 36 | CD19, CD34, CD14 | |||
| Eosinophils | 90 | 88 | CCR3 | |||
| T Cells | 8 | 4 | CD4, CD8 |
Fig. 4. Identification of subsets of cells expressing the CysLT1 receptor among PBMC. (A, D, G, and J ) CysLT1 receptor immunoreactivity (Texas Red fluorescence). (B, E, H, and K ) Identification markers for CD14 (B); CD19 (E ); CD34 (H ); IL-5 receptor β-subunit (K ). Positive immunoreactivity is shown by green fluorescence of FITC in all. (C, F, I, and L) Colocalization of CysLT1 receptor with CD14 (C ); CD19 (F ); CD34 (I ); IL-5 receptor β-subunit (seen as yellow fluorescence) (L). All scale bars = 5 μm.
[More] [Minimize]Because eosinophils have been suggested to exacerbate inflammation in asthma, and CysLTs have been shown to be potent chemoattractants for eosinophils both in vitro and in vivo (27-29), we next investigated whether the CysLT1 receptor is expressed on human peripheral blood eosinophils. In purified populations of eosinophils from hypereosinophilic but nonasthmatic subjects, we observed specific expression of CysLT1 receptor mRNA and protein (Figures 5A and 5D). The majority of these cells also showed immunoreactivity for the CCR3 receptor, a beta-chemokine receptor expressed on eosinophils (21) (Figures 5D through 5F; Table 1).
Fig. 5. Expression of the CysLT1 receptor in eosinophils purified from peripheral blood. (A and B) In situ hybridization for CysLT1 receptor. (A) Antisense probe, Texas Red fluorescence, nuclei are of blue/purple color from DAPI; (B) sense control probe. (C through G) Immunohistochemistry. (C ) Preimmune control goat antiserum, nuclei are blue/purple color from DAPI; (E ) CysLT1 receptor immunoreactivity (Texas Red fluorescence), nuclei are blue/purple color from DAPI; (F ) CCR3 receptor immunoreactivity (green fluorescence from fluorescein isothiocyanate); (G) combined CysLT1 and CCR3 receptor immunoreactivities with colocalization seen as yellow. All scale bars = 5 μm.
[More] [Minimize]In a population of T cells purified from our samples of peripheral blood cells from nonasthmatic subjects, the CysLT1 receptor mRNA or protein was rarely present, in contrast to the abundant CysLT1 receptor expression demonstrated on eosinophils and some classes of monocytes (CD14+) and B lymphocytes (CD19+) (Figures 6A through 6D; Table 1). We were able to demonstrate both CD4+ and CD8+ helper T cells in this preparation, and neither of these subsets of T cells expressed the CysLT1 receptor (Figures 6A through 6D). CysLT1 receptor expression may be upregulated in lymphocytes from asthmatic subjects. Quantification of the expression of CysLT1 receptor mRNA and protein in populations of normal human peripheral blood cells is shown in Table 1.
Fig. 6. CD4+ and CD8+ human peripheral blood T cells do not express the CysLT1 receptor. (A and C ) CysLT1 receptor immunoreactivity (Texas Red fluorescence) with nuclei of blue/purple color from DAPI. (B) CD4 immunoreactivity (green fluorescence from fluorescein isothiocyanate) on same cell population as in A. (D) CD8 immunoreactivity (green fluorescence from fluorescein isothiocyanate) on same cell population as in C. All scale bars = 15 μm.
[More] [Minimize]We report here the immunohistochemical identification of the CysLT1 receptor protein in normal human lung and normal human peripheral blood cells, in accord with the in situ expression of CysLT1 mRNA in human lung smooth-muscle cells and macrophages demonstrated by the molecular cloning of the CysLT1 receptor (17). With a panel of peripheral blood cell markers, we further found that the receptor is expressed in cells of particular relevance to asthma and atopy, namely eosinophils, monocytes/macrophages, and B lymphocytes, and in CD34+ granulocytic precursor cells. The demonstration of the CysLT1 receptor on eosinophils concurs with observations that CysLT1 receptor antagonists inhibit eosinophil chemotaxis and airway inflammation (30, 31), and that CysLTs partly mediate eotaxin-induced bronchial hyperresponsiveness and eosinophilia in IL-5–transgenic mice (32). The expression of the CysLT1 receptor on monocytes is consistent with previous CysLT1 receptor binding characterizations and with functional activation studies of premyelocytic HL-60 and THP-1 cells (9). Ours is the first demonstration of the CysLT1 receptor on B lymphocytes, although the receptor has been well characterized on the lymphoblastoid U937 cell line, and B lymphocytes have been shown to produce leukotrienes under some conditions (9, 33). The demonstration of the CysLT1 receptor on CD34+ pregranulocytic cells is intriguing, given the detection of increased numbers of CD34+ cells in bronchial biopsy specimens from atopic asthmatic and atopic nonasthmatic subjects (34). The receptor was neither in peripheral polymorphonuclear leukocytes nor in the majority of T cells, in accord with most reports in the literature (9).
The expression of the CysLT receptor on eosinophils and monocytes, both of which are cell types capable of synthesizing CysLTs, suggests that both autocrine and paracrine activation may occur after stimulation by the appropriate inflammatory signal. The expression of the CysLT1 receptor on pregranulocytic CD34+ cells raises the possibility that under some conditions, CysLTs may influence the differentiation pathway of these cells. A subset of cells expressing the IL-5 receptor β-chain (common to the IL-5, IL-3, and granulocyte–macrophage colony-stimulating factor receptors) also coexpressed the CysLT1 receptor. We hypothesize that CysLTs prime the maturation of CD34+ precursor cells to eosinophils, monocytes/ macrophages, and subsets of lymphocytic cells in the peripheral blood compartment (Figure 7). During an asthmatic exacerbation, CysLTs produced in the lung by eosinophils and macrophages (and also by mast cells in an atopic patient) may activate bronchial smooth-muscle CysLT1 receptors, producing bronchoconstriction. In addition, the CysLTs may act in an autocrine and paracrine fashion on CysLT1 receptors on interstitial precursor granulocytes, eosinophils, and macrophages, thereby amplifying both the immediate lung damage and expanding the populations of inflammatory cells in the lung (Figure 7). Such a positive feedback mechanism may in part explain the clinically observed progressively refractory bronchospasm and inflammation that characterize asthma.
Fig. 7. Proposed model of role of CysLT1 receptor in human peripheral blood cells. A pluripotent, CD34+ hemopoietic progenitor cell may be primed to differentiate to mature blood cells by a variety of cytokines, through their appropriate receptors, and by CysLT activation of the CysLT1 receptor.
[More] [Minimize]Our characterization of the expression of the CysLT1 receptor in the lung is consistent with that in many pharmacologic and clinical studies of the effects of CysLTs and specific CysLT1 receptor antagonists. In addition, the localization of the CysLT1 receptor on subsets of B-lymphocytic (CD19+) and pregranulocytic (CD34+) cells suggests undiscovered roles of CysLTs in these cell types. Future work will focus on the molecular expression and activation of the receptor in asthma and other diseases.
The authors thank Drs. H. Zweerink, J. Mudgett, M. Cascieri, F. Nantel, A. W. Ford-Hutchinson, C. T. Caskey, and T. Reiss for support of this project.
Supported in part by NIH Grants DK46205 and GM-15431 (R.M.B).
| 1. | Samuelsson BLeukotrienes: mediators of immediate hypersensitivity reactions and inflammation. Science2201983568575 |
| 2. | Lewis RA, Austen KF, Soberman RJLeukotrienes and other products of the 5-lipoxygenase pathway: biochemistry and relation to pathobiology in human diseases. N Engl J Med3231990645655 |
| 3. | Penrose JF, Spector J, Baldasaro M, Xu K, Boyce J, Arm JP, Austen KF, Lam BKMolecular cloning of the gene for human leukotriene C4 synthase. Organization, nucleotide sequence, and chromosomal localization to 5q35. J Biol Chem27119961135611361 |
| 4. | Sampson AP, Castling DP, Green CP, Price JFPersistent increases in plasma and urinary leukotrienes after acute asthma. Arch Dis Child731995221225 |
| 5. | Reiss TF, Hill JB, Harman E, Zhang J, Tanaka WK, Bronsky E, Guerreiro D, Hendeles LIncreased urinary excretion of LTE4 after exercise and attenuation of exercise-induced bronchospasm by montelukast, a cysteinyl leukotriene receptor antagonist. Thorax52199710301035 |
| 6. | van Schaik SM, Tristam DA, Nagpal IS, Hintz KM, Welliver RC, Welliver RCIncreased production of IFN-gamma and cysteinyl leukotrienes in virus-induced wheezing. J Allergy Clin Immunol1031999630636 |
| 7. | O'Sullivan S, Dahlen S-E, Larsson BM, Malmberg P, Kumlin M, Palmberg LExposure of healthy volunteers to swine house dust increases formation of leukotrienes, prostaglandin D2 and bronchial responsiveness to methacholine. Thorax53199810411046 |
| 8. | Coleman RA, et al. Prostanoid and leukotriene receptors: a progress report from the IUPHAR working parties on classification and nomenclature. In: Samuelsson B, et al, editors. Advances in prostaglandin, thromboxane and leukotriene research, vol 23. New York: Raven Press; 1994. p. 283–285. |
| 9. | Metters KMLeukotriene receptors. J Lipid Mediat Cell Signal121995413427 |
| 10. | Reiss TF, Chervinsky P, Dockhorn RJ, Shingo S, Seidenberg B, Edwards TB, Montelukast Clinical Research Study Group. Montelukast, a once-daily leukotriene receptor antagonist, in the treatment of chronic asthma: a multicenter, randomized, double-blind trial. Arch Intern Med 1998;158:1213–1220. |
| 11. | Knorr B, Matz J, Bernstein JA, Nguyen H, Seidenberg BC, Reiss TF, Becker A, Pediatric Montelukast Study Group. Montelukast for chronic asthma in 6- to 14-year-old children: a randomized, double-blind trial. JAMA 1998;279:1181–1186. |
| 12. | Leff JA, Busse WW, Pearlman D, Bronsky EA, Kemp J, Hendeles L, Dockhorn R, Kundu S, Zhang J, Seidenberg BC, Reiss TFMontelukast, a leukotriene-receptor antagonist, for the treatment of mild asthma and exercise-induced bronchoconstriction. N Engl J Med3391998147152 |
| 13. | Diamant Z, Grootendorst DC, Veselic-Charvant M, Timmers MC, De Smet M, Leff JA, Seidenberg BC, Zwinderman AH, Peszek I, Sterk PJThe effect of montelukast (MK-0476), a cysteinyl leukotriene receptor antagonist, on allergen-induced airway responses and sputum cell counts in asthma. Clin Exp Allergy2919994251 |
| 14. | Malmstrom K, Rodriguez-Gomez G, Guerra J, Villaran C, Pineiro A, Wei LX, Seidenberg BC, Reiss TF, Montelukast/Beclomethasone Study Group. Oral montelukast, inhaled beclomethasone, and placebo for chronic asthma: a randomized, controlled trial. Ann Intern Med 1999;130:487–495. |
| 15. | Suissa S, Dennis R, Ernst P, Sheehy O, Wood-Dauphinee SEffectiveness of the leukotriene receptor antagonist zafirlukast for mild-moderate asthma. Ann Intern Med1261997177183 |
| 16. | Grossman J, Faiferman I, Dubb JW, Thompson DJ, Busse W, Bronsky E, Montanaro A, Southern L, Tinkleman DResults of the first U.S. double-blind, placebo-controlled multicenter clinical trial in asthma with pranlukast, a novel leukotriene receptor antagonist. J Asthma341997321328 |
| 17. | Lynch KR, O'Neill GP, Liu Q, Im D-S, Sawyer N, Metters KM, Coulombe N, Abramovitz M, Figueroa DJ, Zeng Z, et al.. Characterization of the human cysteinyl leukotriene CysLT1 receptor. Nature3991999789793 |
| 18. | Sarau HM, Ames RS, Chambers J, Ellis C, Elshourbagy N, Foley JJ, Schmidt DB, Muccitelli RM, Jenkins O, Murdock PR, et al.. Identification, molecular cloning, expression and characterization of a cysteinyl leukotriene receptor. Mol Pharmacol561999657663 |
| 19. | Labat C, Ortiz JL, Norel X, Gorenne I, Verley J, Abram TS, Cuthburt NJ, Tudhope SR, Norman P, Gardiner P, et al.. A second cysteinyl leukotriene receptor in human lung. J Pharmacol Exp Ther2631992800805 |
| 20. | Hishino M, Izumi T, Shimizu TLeukotriene D4 activates mitogen-activated protein kinase through a protein kinase Cα-Raf-1-dependent pathway in human monocytic leukemia THP-1 cells. J Biol Chem273199848784882 |
| 21. | Daugherty BL, Siciliano SJ, DeMartino JA, Malkowitz L, Sirotina A, Springer MSCloning, expression, and characterization of the human eosinophil eotaxin receptor. J Exp Med183199623492354 |
| 22. | Busse WWLeukotrienes and inflammation. Am J Respir Crit Care Med1571998210213 |
| 23. | Ferrero E, Hsieh CL, Francke U, Goyert SMCD14 is a member of the family of leucine-rich proteins and is encoded by a gene syntenic with multiple receptor genes. J Immunol1451990331336 |
| 24. | Su L, Rickert RC, David MRapid STAT phosphorylation via the B cell receptor: modulatory role of CD19. J Biol Chem27419993177031774 |
| 25. | Jesaitis AJ, Tolley JO, Bokoch GM, Allen RARegulation of chemoattractant receptor interaction with transducing proteins by organizational control in the plasma membrane of human neutrophils. J Cell Biol109198927832790 |
| 26. | Welker P, Grabbe J, Zuberbier T, Guhl S, Henz BMMast cell and myeloid marker expression during early in vitro mast cell differentiation from human peripheral blood mononuclear cells. J Invest Dermatol11420004450 |
| 27. | Spada CS, Nieves AL, Krauss AH, Woodward DFComparison of leukotriene B4 and D4 effects on human eosinophil and neutrophil motility in vitro. J Leukoc Biol551994183191 |
| 28. | Laitinen LA, Laitinen A, Haahtela T, Vilkka V, Spur BW, Lee THLeukotriene E4 and granulocytic infiltration into asthmatic airways. Lancet3411993989990 |
| 29. | Diamant Z, Hilterman JT, van Rensen EL, Callenbach PM, Veselic-Charvant M, van der Veen H, Sont JK, Sterk PJThe effect of inhaled leukotriene D4 and methacholine on sputum cell differentials in asthma. Am J Respir Crit Care Med155199712471253 |
| 30. | Munoz NM, Douglas I, Mayer D, Herrnreiter A, Zhu X, Leff AREosinophil chemotaxis inhibited by 5-lipoxygenase blockade and leukotriene receptor antagonism. Am J Respir Crit Care Med155199713981403 |
| 31. | Pizzichini E, Leff JA, Reiss TF, Hendeles L, Boulet LP, Wei LX, Efthimiadis AE, Zhang J, Hargreave FEMontelukast reduces airway eosinophilic inflammation in asthma: a randomized, controlled trial. Eur Respir J1419991218 |
| 32. | Hisada T, Salmon M, Nasuhara Y, Chung KFCysteinyl leukotrienes partly mediate eotaxin-induced bronchial hyperresponsiveness and eosinophilia in IL-5 transgenic mice. Am J Respir Crit Care Med1601999571575 |
| 33. | Jakobsson PJ, Steinhilber D, Odlander B, Radmark O, Claesson HE, Samuelsson BOn the expression and regulation of 5-lipoxygenase in human lymphocytes. Proc Natl Acad Sci USA89199235213525 |
| 34. | Robinson DS, Damia R, Zeibecoglou K, Molet S, North J, Yamada T, Kay BA, Hamid QCD34+/interleukin-5α messenger RNA+ cells in the bronchial mucosa in asthma: potential airway eosinophil progenitors. Am J Respir Cell Mol Biol201999913 |
