Twelve subjects with mild stable asthma (Table 1) who were receiving treatment with only the inhaled β₂-adrenergic agonist aerosol, albuterol, for intermittent relief of wheeze were recruited. All patients demonstrated > 15% improvement in FEV₁ following 200 μg of albuterol and in airway hyperresponsiveness to methacholine with a provocative concentration of methacholine producing a 20% fall in FEV₁ (PC₂₀) of < 4 mg/ml. All patients were atopic as defined by two or more positive skin prick tests to common allergens. None of the subjects studied had received oral or inhaled corticosteroids for the preceding 12 mo or any other treatment apart from inhaled β₂ agonists. Current smokers or ex-smokers of > 5 pack-years and patients with FEV₁ < 80% predicted were excluded.

In order to compare the responses of monocytes and alveolar macrophages obtained from asthmatic subjects during placebo and budesonide treatment, we studied seven normal nonatopic nonsmoking volunteers (Table ), who gave no history of asthma or of any respiratory disease and who had normal lung function and airway responsiveness to methacholine (PC₂₀ > 16 mg/ml).

The study was a 12-wk, double-blind, randomized, cross-over study comparing the effects of inhaled corticosteroid, budesonide (800 μg twice daily), to that of placebo. Each treatment was administered for 4 wk, separated by a 4-wk wash-out phase. All patients were reviewed at Day 14 of each treatment limb, and at Day 26, spirometry and airway responsiveness to methacholine were measured. At Day 28, venous blood samples were obtained and fiberoptic bronchoscopy was performed. The study was approved by the Royal Brompton Hospital Ethics Committee, and all patients gave their informed consent.

Subjects attended our bronchoscopy suite at 8:30 a.m. after having fasted from midnight and were pretreated with atropine (0.6 mg intravenously) and midazolam (5 to 10 mg intravenously). Using local anesthesia with lidocaine (4%) to the upper airways and larynx, a fiberoptic bronchoscope (Olympus BF10; Southend-on-Sea, Essex, UK) was passed through the nasal passages into the trachea. Bronchoalveolar lavage (BAL) was performed from the right middle lobe using four successive aliquots of 60 ml of 0.9% NaCl. BAL cells were spun (500 × g; 10 min) and washed twice with Hanks' buffered salt solution (HBSS). Cytospins were prepared and stained with May-Grünwald stain for differential cell counts. Cell viability was assessed using the trypan blue exclusion method. Cells (5 × 10⁵) were placed in guanidinium thiocyanate and left at −70° C for later RNA extraction.

IL-1β was purchased from R&D Laboratories (Oxford, UK). Human recombinant MIP-1α and anti-MIP-1α antibody was a gift from T. J. Schall (DNAX, Palo Alto, CA). Complete culture medium contained RPMI-1640 (ICN-Flow, High Wycombe, UK), 10% heat-inactivated fetal calf serum (Sera Lab, Crawley, UK) 2 mM l-glutamine, and penicillin (100 U/ml)-streptomycin (100 μg/ml) (both from ICN-Flow). Culture plates were from Falcon (London, UK). Lipopolysaccharide (Escherichia coli), avidin-peroxidase, and ABTS were from Sigma (Poole, UK). [³²P]dCTP, [¹²⁵I]NA, and hybond N-filters were from Amersham International (Amersham, UK). Ficoll-Hypaque was from Pharmacia Biotech (Hertfordshire, UK). Round-bottom, 96-well plates were from Greiner Labortechnik Ltd (London, UK).

Peripheral venous blood was mixed with acid-citrate dextrose (1:6, vol/vol) and sedimented on dextran (6% in 0.9% NaCl) for 40 min. Mononuclear cells were separated by Ficoll-Hypaque density centrifugation. Cells were washed twice with HBSS and plated at a concentration of 5 × 10⁶ monocytes/2 ml in 6-well plates for Northern analysis or 1 × 10⁶/ml in 24-well plates for reverse-transcription polymerase chain reaction (RT-PCR) and collection of supernatants for cytokine assays. After adherence at 37° C for 90 min, cells were washed twice with HBSS prior to stimulation. Cell viability was consistently > 96%, as assessed by trypan blue exclusion; after adherence, > 95% of these cells were monocytes, as assessed by nonspecific esterase staining.

BAL fluid was filtered through sterile gauze and centrifuged at 500 × g for 10 min. Cells were washed twice in HBSS, counted, and plated in complete media at a concentration of 1 × 10⁶/ml in a 24-well plate. In normal subjects, the total cell yield was 12 ± 7 × 10⁶ cells with a differential cell count of 93 ± 2% macrophages, 6.6 ± 2% lymphocytes, and 0.4 ± 1% neutrophils. In asthmatic subjects, the yield was 11 ± 4.4 × 10⁶ cells with 88.6 ± 3.1% macrophages, 8.6 ± 2.6% lymphocytes, 1.1 ± 0.4% neutrophils, and 1.6 ± 1.0% eosinophils. Cells were > 85% viable, as assessed by trypan blue exclusion.

RNA was extracted using a modification of the method of Chomczynski and Sacchi (21) and its purity assessed by spectrophotometry. Reverse transcription of 1 μg of total RNA was performed using AMV-reverse transcriptase (15 U), 10 mM of dATP, dCTP, dGTP, and dTTP, oligo dT15 primer (0.2 μg), RNase inhibitor (30 U), and 5× AMV buffer in a total volume of 8.5 μl (all from Promega, Southampton, UK). RNA was denatured at 65° C for 10 min. The remaining ingredients were then added as a master mix, and samples were incubated at 42° C for 60 min followed by 4 min at 90° C. The cDNA was subsequently diluted to a final volume of 100 μl in nuclease-free water. For PCR, 5 μl of the cDNA solutions were used. PCR was performed using 0.5 μg/μl of forward and reverse primers, dATP, dGTP, dTTP, and dCTP, at a concentration of 10 mM each, Taq polymerase (0.5 U), and buffer A in a final volume of 25 μl (all from Promega) set for 29 cycles for IL-10 and 28 cycles for GAPDH at a denaturing temperature of 94° C for 30 s, specific annealing temperature of 65° C for IL-10 and 58° C for GAPDH, and extension temperature of 72° C for 30 s. Primers for IL-10 were 5′ ATGCCCCAAGCTGAGAACCAAGACCCA and 3′ TCTCAAGGGGCTGGGTCAGCTATCCCA, giving a product of 351 base pairs. Primers for GAPDH were 5′ TCTAGACGGCAGGCTAGGTCCACC and 3′ CCACCCATGGCAAATTCCATGGCA, giving a product of 598 base pairs. PCR was carried out in a Techne multiwell thermocycler (Techne, Cambridge, UK). The number of cycles was chosen after determination of the linear phase of the product amplification curve from serial sampling with increasing cycles of amplification. Products were distinguished by electrophoresis on a 1.5% agarose, ethidium bromide–stained gel and then visualized using ultraviolet luminescence.

Southern blot analysis was performed. The 1.5% agarose gels were denatured, neutralized, and blotted onto nylon membranes. DNA was cross-linked to the membrane by ultraviolet light. Membranes were incubated for 4 h at 65° C in buffer D (6× SSC, 5× Denhardt's solution, 20 mM NaH₂PO₄, 0.1% wt/vol SDS, 250 μg/ml sonicated salmon sperm DNA) and hybridized at 65° C overnight in the same buffer with ³²P-radiolabeled gene-specific internal oligonucleotide probes directed against a sequence internal to the specific PCR product. Filters were washed twice in 3× SSC/0.1% SDS for 15 min at 65° C, once with 1× SSC/0.1% SDS for 30 min at 65° C, and finally twice with 0.1× SSC/0.1% SDS for 30 min at 65° C. Each filter was then exposed for 6 to 24 h to Kodak (Rochester, NY) X-OMAT film and developed. In addition, 5 μl of each PCR product was dot-blotted and hybridized according to the above-described method to allow quantitation by Cerenkov counting of the filters. Data are expressed as the ratio of IL-10 to GAPDH cDNA.

Recombinant MIP-1α was iodinated (2.5 μg) using iodogen as previously described (22). The competitive binding assay was as previously described for the complement activation product C5a (23). Briefly, cell culture supernatant fluid (100 μl) was mixed with 11% polyethylene glycol 6,000 containing 0.5% protamine sulfate (100 μl), [¹²⁵I]ligand (6 fmol in 50 μl), and antibody (50 μl of rabbit anti-MIP-1α antibody diluted 1:50). After 24 h of incubation at room temperature, radioactivity was precipitated using 25 μl of goat anti-rabbit IgG (Nordik, UK). The lower limit of adequate measurement (the concentration required to inhibit [¹²⁵I]ligand binding by 20%) was 12 pM. This assay was specific for MIP-1α and did not cross-react with other chemokines, including MIP-1β, RANTES, and monocyte chemoattractant protein-1 (MCP-1).

These cytokines were assayed using a quantitative sandwich enzyme immunoassay technique. For IL-10 and IFN-γ, commercially available kits were used (Quantikine; R&D Systems, Abingdon, Oxon, UK). Briefly, monoclonal anti-IL-10 or anti-IFN-γ antibody was coated onto a microtiter plate, to which standards and samples were added. An enzyme-linked polyclonal antibody specific for IL-10 or IFN-γ was added to the wells to sandwich-immobilized IL-10 or IFN-γ. Addition of a stabilized chromogen and hydrogen peroxide allowed a color development in proportion to the amount of IL-10 or IFN-γ assayed by measurement of optical density using a spectrophotometer set to 450 nm. The lower limit of detection was 1.5 and 2 pg/ml for IL-10 and IFN-γ, respectively.

For GM-CSF assay, round-bottom plates were coated overnight at 4° C with a rat anti-human GM-CSF monoclonal antibody of (50 μl of 2 μg/ml). After washing with phosphate-buffered saline (PBS)/Tween, the antibody was blocked with PBS/10% fetal calf serum (200 μl; 2 h). GM-CSF standard and samples were added to the plate overnight at 4° C and washed with PBS/Tween (four times). A biotinylated secondary anti-GM-CSF antibody (100 μl of 2 μg/ml in PBS/10% fetal calf serum) was added for 45 min followed by 1:400 avidin-peroxidase solution (100 μl). After washing, GM-CSF was measured colometrically at 405 nm and quantified by interpolation from a standard curve. The lower limit of detection was 16 pg/ml.

Data are reported as mean ± SEM. Data obtained within the asthmatic group during the placebo and active periods were compared using the nonparametric Wilcoxon's test. To compare the data between asthmatics and normal volunteers, the nonparametric Mann-Whitney test was used. A p value of < 0.05 was considered to be significant.